EMAIL THIS PAGE TO A FRIEND

STXBP1

syntaxin binding protein 1

Synonyms: MUNC18-1 NSEC1 P67 RBSEC1 UNC18
UniProtKB ID: P61764, B1AM97, Q28208, Q62759, Q64320, Q96TG8
Gene ID:
Human(6812) Summary: This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Mouse(20910) syntaxin binding protein 1
Rat(25558) syntaxin binding protein 1
naked mole-rat(101726395) syntaxin binding protein 1
domestic guinea pig(100726839) syntaxin binding protein 1
cow(282378) syntaxin binding protein 1
sheep(101103306) syntaxin binding protein 1
chicken(404293) syntaxin binding protein 1
dog(609241) syntaxin binding protein 1
domestic cat(101092061) syntaxin binding protein 1
Horse(100070499) syntaxin binding protein 1
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M4438 Anti-Munc-18 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat
immunoprecipitation, western blot pricing
M2694 Anti-Munc-18-1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat
immunofluorescence, microarray, western blot pricing
SAB4502895 Anti-MUNC-18A antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
SAB2500659 Anti-MUNC18/STXBP1 (Isoform A) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503941 Anti-phospho-MUNC-18a (pSer313) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA008209 Anti-STXBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA023483 Anti-STXBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB2102330 Anti-STXBP1 antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, human, rabbit, zebrafish, bovine, horse
western blot pricing
WH0006812M1 Monoclonal Anti-STXBP1 antibody produced in mouse clone 6D1, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003165 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032221 Rosetta Predictions human pricing
NM_003165 Rosetta Predictions human pricing
NM_013038 Rosetta Predictions rat pricing
NM_001113569 Rosetta Predictions mouse pricing
NM_009295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100122 predicted 272
2 SASI_Hs01_00100123 predicted 512
3 SASI_Hs01_00100124 predicted 1583
4 SASI_Hs01_00100125 predicted 533
5 SASI_Hs01_00100126 predicted 750
6 SASI_Hs01_00100127 predicted 596
7 SASI_Hs01_00100128 predicted 1049
8 SASI_Hs01_00100129 predicted 1581
9 SASI_Hs01_00100130 predicted 509
10 SASI_Hs01_00100131 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039381 predicted 272
2 SASI_Hs01_00039382 predicted 506
3 SASI_Hs01_00039383 predicted 1576
4 SASI_Hs01_00039384 predicted 527
5 SASI_Hs01_00039385 predicted 748
6 SASI_Hs01_00039386 predicted 602
7 SASI_Hs01_00039387 predicted 1044
8 SASI_Hs01_00039388 predicted 1575
9 SASI_Hs01_00039389 predicted 503
10 SASI_Hs01_00039390 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113248 predicted 401
2 SASI_Rn01_00113249 predicted 1555
3 SASI_Rn01_00113251 predicted 860
4 SASI_Rn01_00113252 predicted 1321
5 SASI_Rn01_00113253 predicted 1600
6 SASI_Rn01_00113254 predicted 513
7 SASI_Rn01_00113255 predicted 1165
8 SASI_Rn01_00113256 predicted 980
9 SASI_Rn01_00113257 predicted 1477
10 SASI_Rn02_00260751 predicted 494
11 SASI_Rn01_00113250 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308259 predicted 285
2 SASI_Mm02_00308260 predicted 902
3 SASI_Mm02_00308261 predicted 556
4 SASI_Mm02_00308262 predicted 529
5 SASI_Mm02_00308263 predicted 1353
6 SASI_Mm02_00308264 predicted 1628
7 SASI_Mm02_00308265 predicted 1580
8 SASI_Mm02_00308266 predicted 1607
9 SASI_Mm02_00308267 predicted 695
10 SASI_Mm02_00308268 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315818 predicted 285
2 SASI_Mm01_00027974 predicted 890
3 SASI_Mm01_00027975 predicted 549
4 SASI_Mm01_00027976 predicted 527
5 SASI_Mm01_00027977 predicted 1355
6 SASI_Mm02_00315819 predicted 1618
7 SASI_Mm02_00315820 predicted 1575
8 SASI_Mm01_00027979 predicted 1611
9 SASI_Mm01_00027980 predicted 695
10 SASI_Mm02_00315821 predicted 1534
11 SASI_Mm01_00027973 predicted 1730
12 SASI_Mm01_00027978 predicted 912
13 SASI_Mm01_00027981 predicted 197
14 SASI_Mm01_00027982 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009295
STXBP1 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-292s21c1
Sequence:GTACCGGATGACCGAGGGCATCACAATTCTCGAGAATTGTGATGCCCTCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-1579s21c1
Sequence:CCGGCCGATCATTAAAGACATTATGCTCGAGCATAATGTCTTTAATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009295.2-2305s21c1
Sequence:CCGGCAAGCTTGGTTGGATTCATTTCTCGAGAAATGAATCCAACCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-466s21c1
Sequence:CCGGTCGTGTCCAGATGCCCTATTTCTCGAGAAATAGGGCATCTGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-393s21c1
Sequence:GTACCGGCCACTCTCTGATCAGTGATTTCTCGAGAAATCACTGATCAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-760s21c1
Sequence:CCGGGACAAGCTGGATGCCTATAAACTCGAGTTTATAGGCATCCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-527s21c1
Sequence:CCGGCGCTGACGGAAATCAACATTGCTCGAGCAATGTTGATTTCCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-883s21c1
Sequence:GTACCGGACATTCCAGGCTATGAGTTATCTCGAGATAACTCATAGCCTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009295.1-2674s1c1
Sequence:CCGGCCTCAGTTTAAGATACTTCATCTCGAGATGAAGTATCTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-372s1c1
Sequence:CCGGGCCCTATTTAACGAGCTGGTACTCGAGTACCAGCTCGTTAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1472s1c1
Sequence:CCGGCCCGATCATTAAAGACATTATCTCGAGATAATGTCTTTAATGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1775s1c1
Sequence:CCGGCACGCTGAAGAAGCTGAATAACTCGAGTTATTCAGCTTCTTCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-361s1c1
Sequence:CCGGCGTGTCCAGATGCCCTATTTACTCGAGTAAATAGGGCATCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009295
STXBP1 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-292s21c1
Sequence:GTACCGGATGACCGAGGGCATCACAATTCTCGAGAATTGTGATGCCCTCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-1579s21c1
Sequence:CCGGCCGATCATTAAAGACATTATGCTCGAGCATAATGTCTTTAATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009295.2-2305s21c1
Sequence:CCGGCAAGCTTGGTTGGATTCATTTCTCGAGAAATGAATCCAACCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-466s21c1
Sequence:CCGGTCGTGTCCAGATGCCCTATTTCTCGAGAAATAGGGCATCTGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-393s21c1
Sequence:GTACCGGCCACTCTCTGATCAGTGATTTCTCGAGAAATCACTGATCAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-760s21c1
Sequence:CCGGGACAAGCTGGATGCCTATAAACTCGAGTTTATAGGCATCCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-527s21c1
Sequence:CCGGCGCTGACGGAAATCAACATTGCTCGAGCAATGTTGATTTCCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-883s21c1
Sequence:GTACCGGACATTCCAGGCTATGAGTTATCTCGAGATAACTCATAGCCTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009295.1-2674s1c1
Sequence:CCGGCCTCAGTTTAAGATACTTCATCTCGAGATGAAGTATCTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-372s1c1
Sequence:CCGGGCCCTATTTAACGAGCTGGTACTCGAGTACCAGCTCGTTAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1472s1c1
Sequence:CCGGCCCGATCATTAAAGACATTATCTCGAGATAATGTCTTTAATGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1775s1c1
Sequence:CCGGCACGCTGAAGAAGCTGAATAACTCGAGTTATTCAGCTTCTTCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-361s1c1
Sequence:CCGGCGTGTCCAGATGCCCTATTTACTCGAGTAAATAGGGCATCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009295
STXBP1 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-292s21c1
Sequence:GTACCGGATGACCGAGGGCATCACAATTCTCGAGAATTGTGATGCCCTCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-1579s21c1
Sequence:CCGGCCGATCATTAAAGACATTATGCTCGAGCATAATGTCTTTAATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009295.2-2305s21c1
Sequence:CCGGCAAGCTTGGTTGGATTCATTTCTCGAGAAATGAATCCAACCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-466s21c1
Sequence:CCGGTCGTGTCCAGATGCCCTATTTCTCGAGAAATAGGGCATCTGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-393s21c1
Sequence:GTACCGGCCACTCTCTGATCAGTGATTTCTCGAGAAATCACTGATCAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-760s21c1
Sequence:CCGGGACAAGCTGGATGCCTATAAACTCGAGTTTATAGGCATCCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-527s21c1
Sequence:CCGGCGCTGACGGAAATCAACATTGCTCGAGCAATGTTGATTTCCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009295.2-883s21c1
Sequence:GTACCGGACATTCCAGGCTATGAGTTATCTCGAGATAACTCATAGCCTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009295.1-2674s1c1
Sequence:CCGGCCTCAGTTTAAGATACTTCATCTCGAGATGAAGTATCTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-372s1c1
Sequence:CCGGGCCCTATTTAACGAGCTGGTACTCGAGTACCAGCTCGTTAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1472s1c1
Sequence:CCGGCCCGATCATTAAAGACATTATCTCGAGATAATGTCTTTAATGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-1775s1c1
Sequence:CCGGCACGCTGAAGAAGCTGAATAACTCGAGTTATTCAGCTTCTTCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009295.1-361s1c1
Sequence:CCGGCGTGTCCAGATGCCCTATTTACTCGAGTAAATAGGGCATCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003165
VALIDATED
STXBP1 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3167s1c1
Sequence:CCGGGCAGAAACTAAAGCAGCAAATCTCGAGATTTGCTGCTTTAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1177s1c1
Sequence:CCGGGACTGTATGAAGCATTACCAACTCGAGTTGGTAATGCTTCATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1582s1c1
Sequence:CCGGGACACTATTGAGGACAAACTTCTCGAGAAGTTTGTCCTCAATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3059s1c1
Sequence:CCGGCCTCAGTTTCAGATACTTCATCTCGAGATGAAGTATCTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-604s1c1
Sequence:CCGGGCTCAGATGAAGAATCCTATACTCGAGTATAGGATTCTTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003165.1-752s1c1
Sequence:CCGGCCTATAAAGCTGATGATCCAACTCGAGTTGGATCATCAGCTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003165
VALIDATED
STXBP1 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3167s1c1
Sequence:CCGGGCAGAAACTAAAGCAGCAAATCTCGAGATTTGCTGCTTTAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1177s1c1
Sequence:CCGGGACTGTATGAAGCATTACCAACTCGAGTTGGTAATGCTTCATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1582s1c1
Sequence:CCGGGACACTATTGAGGACAAACTTCTCGAGAAGTTTGTCCTCAATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3059s1c1
Sequence:CCGGCCTCAGTTTCAGATACTTCATCTCGAGATGAAGTATCTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-604s1c1
Sequence:CCGGGCTCAGATGAAGAATCCTATACTCGAGTATAGGATTCTTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003165.1-752s1c1
Sequence:CCGGCCTATAAAGCTGATGATCCAACTCGAGTTGGATCATCAGCTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003165
VALIDATED
STXBP1 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3167s1c1
Sequence:CCGGGCAGAAACTAAAGCAGCAAATCTCGAGATTTGCTGCTTTAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1177s1c1
Sequence:CCGGGACTGTATGAAGCATTACCAACTCGAGTTGGTAATGCTTCATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-1582s1c1
Sequence:CCGGGACACTATTGAGGACAAACTTCTCGAGAAGTTTGTCCTCAATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-3059s1c1
Sequence:CCGGCCTCAGTTTCAGATACTTCATCTCGAGATGAAGTATCTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003165.1-604s1c1
Sequence:CCGGGCTCAGATGAAGAATCCTATACTCGAGTATAGGATTCTTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003165.1-752s1c1
Sequence:CCGGCCTATAAAGCTGATGATCCAACTCGAGTTGGATCATCAGCTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks