EMAIL THIS PAGE TO A FRIEND

STXBP2

syntaxin binding protein 2

Synonyms: FHL5 Hunc18b MUNC18-2 UNC18-2 UNC18B pp10122
UniProtKB ID: Q15833, Q9BU65
Gene ID:
Human(6813) Summary: This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
Mouse(20911) syntaxin binding protein 2
Rat(81804) syntaxin binding protein 2
Zebrafish(406578) syntaxin binding protein 2
domestic cat(101096543) syntaxin binding protein 2
dog(403880) syntaxin binding protein 2
cow(515618) syntaxin binding protein 2
sheep(101102061) syntaxin binding protein 2
domestic guinea pig(100720057) syntaxin binding protein 2
naked mole-rat(101702294) syntaxin binding protein 2
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006949 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127396 Rosetta Predictions human pricing
NM_006949 Rosetta Predictions human pricing
NM_031126 Rosetta Predictions rat pricing
NM_011503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329434 predicted 1267
2 SASI_Hs02_00329435 predicted 951
3 SASI_Hs02_00329436 predicted 1001
4 SASI_Hs02_00329437 predicted 771
5 SASI_Hs02_00329438 predicted 1331
6 SASI_Hs02_00329439 predicted 794
7 SASI_Hs02_00329440 predicted 1423
8 SASI_Hs02_00329441 predicted 1304
9 SASI_Hs02_00329442 predicted 855
10 SASI_Hs02_00329443 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015556 predicted 1283
2 SASI_Hs01_00015558 predicted 960
3 SASI_Hs02_00342670 predicted 1014
4 SASI_Hs01_00015559 predicted 786
5 SASI_Hs01_00015560 predicted 1335
6 SASI_Hs01_00015561 predicted 797
7 SASI_Hs01_00015563 predicted 1435
8 SASI_Hs02_00342671 predicted 1317
9 SASI_Hs02_00342672 predicted 865
10 SASI_Hs01_00015564 predicted 1052
11 SASI_Hs01_00015555 predicted 227
12 SASI_Hs01_00015557 predicted 812
13 SASI_Hs01_00015562 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085537 predicted 949
2 SASI_Rn01_00085538 predicted 291
3 SASI_Rn01_00085539 predicted 727
4 SASI_Rn01_00085541 predicted 1696
5 SASI_Rn01_00085542 predicted 794
6 SASI_Rn01_00085543 predicted 304
7 SASI_Rn01_00085544 predicted 459
8 SASI_Rn02_00264439 predicted 920
9 SASI_Rn01_00085545 predicted 542
10 SASI_Rn02_00264440 predicted 461
11 SASI_Rn01_00085540 predicted 1050
12 SASI_Rn01_00085546 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040450 predicted 958
2 SASI_Mm01_00040451 predicted 762
3 SASI_Mm01_00040452 predicted 449
4 SASI_Mm01_00040453 predicted 942
5 SASI_Mm01_00040454 predicted 471
6 SASI_Mm01_00040455 predicted 551
7 SASI_Mm01_00040456 predicted 309
8 SASI_Mm02_00320810 predicted 1638
9 SASI_Mm01_00040457 predicted 795
10 SASI_Mm01_00040458 predicted 893
11 SASI_Mm01_00040459 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011503
VALIDATED
STXBP2 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-223s1c1
Sequence:CCGGCCCAGCTTGGAGGCAATTTATCTCGAGATAAATTGCCTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1612s1c1
Sequence:CCGGCCTAGGCTCATCGTGTACATTCTCGAGAATGTACACGATGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1243s1c1
Sequence:CCGGCTCTACATCCTTCTGCGGAATCTCGAGATTCCGCAGAAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1071s1c1
Sequence:CCGGTGACTGCATGAAGCATTTCAACTCGAGTTGAAATGCTTCATGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-476s1c1
Sequence:CCGGCCTACAACCTTTACTGTCCATCTCGAGATGGACAGTAAAGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011503
VALIDATED
STXBP2 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-223s1c1
Sequence:CCGGCCCAGCTTGGAGGCAATTTATCTCGAGATAAATTGCCTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1612s1c1
Sequence:CCGGCCTAGGCTCATCGTGTACATTCTCGAGAATGTACACGATGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1243s1c1
Sequence:CCGGCTCTACATCCTTCTGCGGAATCTCGAGATTCCGCAGAAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1071s1c1
Sequence:CCGGTGACTGCATGAAGCATTTCAACTCGAGTTGAAATGCTTCATGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-476s1c1
Sequence:CCGGCCTACAACCTTTACTGTCCATCTCGAGATGGACAGTAAAGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011503
VALIDATED
STXBP2 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-223s1c1
Sequence:CCGGCCCAGCTTGGAGGCAATTTATCTCGAGATAAATTGCCTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1612s1c1
Sequence:CCGGCCTAGGCTCATCGTGTACATTCTCGAGAATGTACACGATGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1243s1c1
Sequence:CCGGCTCTACATCCTTCTGCGGAATCTCGAGATTCCGCAGAAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-1071s1c1
Sequence:CCGGTGACTGCATGAAGCATTTCAACTCGAGTTGAAATGCTTCATGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011503.2-476s1c1
Sequence:CCGGCCTACAACCTTTACTGTCCATCTCGAGATGGACAGTAAAGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006949
VALIDATED
STXBP2 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-781s1c1
Sequence:CCGGGCGTATGATCTGCTGGACATACTCGAGTATGTCCAGCAGATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1452s1c1
Sequence:CCGGCCCGGTCATCAAGGATGTAATCTCGAGATTACATCCTTGATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1249s1c1
Sequence:CCGGCTCTACATCCTCCTTCGGAATCTCGAGATTCCGAAGGAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006949.1-72s1c1
Sequence:CCGGCGGAGTTATTCGGAGTGTCAACTCGAGTTGACACTCCGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-186s1c1
Sequence:CCGGCATCACCATTGTTGAAGACATCTCGAGATGTCTTCAACAATGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-250s21c1
Sequence:CCGGCCCAGTCTGGAGGCCATTTATCTCGAGATAAATGGCCTCCAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1055s21c1
Sequence:CCGGAGAAGGAGCTGAATAAGTATTCTCGAGAATACTTATTCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1087s21c1
Sequence:GTACCGGCATCTAGCAGATGATTGTATGCTCGAGCATACAATCATCTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-912s21c1
Sequence:CCGGGGAGCTTCGCCACATGCATATCTCGAGATATGCATGTGGCGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-803s21c1
Sequence:CCGGCGTATGATCTGCTGGACATAGCTCGAGCTATGTCCAGCAGATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006949
VALIDATED
STXBP2 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-781s1c1
Sequence:CCGGGCGTATGATCTGCTGGACATACTCGAGTATGTCCAGCAGATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1452s1c1
Sequence:CCGGCCCGGTCATCAAGGATGTAATCTCGAGATTACATCCTTGATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1249s1c1
Sequence:CCGGCTCTACATCCTCCTTCGGAATCTCGAGATTCCGAAGGAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006949.1-72s1c1
Sequence:CCGGCGGAGTTATTCGGAGTGTCAACTCGAGTTGACACTCCGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-186s1c1
Sequence:CCGGCATCACCATTGTTGAAGACATCTCGAGATGTCTTCAACAATGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-250s21c1
Sequence:CCGGCCCAGTCTGGAGGCCATTTATCTCGAGATAAATGGCCTCCAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1055s21c1
Sequence:CCGGAGAAGGAGCTGAATAAGTATTCTCGAGAATACTTATTCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1087s21c1
Sequence:GTACCGGCATCTAGCAGATGATTGTATGCTCGAGCATACAATCATCTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-912s21c1
Sequence:CCGGGGAGCTTCGCCACATGCATATCTCGAGATATGCATGTGGCGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-803s21c1
Sequence:CCGGCGTATGATCTGCTGGACATAGCTCGAGCTATGTCCAGCAGATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006949
VALIDATED
STXBP2 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-781s1c1
Sequence:CCGGGCGTATGATCTGCTGGACATACTCGAGTATGTCCAGCAGATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1452s1c1
Sequence:CCGGCCCGGTCATCAAGGATGTAATCTCGAGATTACATCCTTGATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-1249s1c1
Sequence:CCGGCTCTACATCCTCCTTCGGAATCTCGAGATTCCGAAGGAGGATGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006949.1-72s1c1
Sequence:CCGGCGGAGTTATTCGGAGTGTCAACTCGAGTTGACACTCCGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006949.1-186s1c1
Sequence:CCGGCATCACCATTGTTGAAGACATCTCGAGATGTCTTCAACAATGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-250s21c1
Sequence:CCGGCCCAGTCTGGAGGCCATTTATCTCGAGATAAATGGCCTCCAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1055s21c1
Sequence:CCGGAGAAGGAGCTGAATAAGTATTCTCGAGAATACTTATTCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-1087s21c1
Sequence:GTACCGGCATCTAGCAGATGATTGTATGCTCGAGCATACAATCATCTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-912s21c1
Sequence:CCGGGGAGCTTCGCCACATGCATATCTCGAGATATGCATGTGGCGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006949.2-803s21c1
Sequence:CCGGCGTATGATCTGCTGGACATAGCTCGAGCTATGTCCAGCAGATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks