EMAIL THIS PAGE TO A FRIEND

STXBP3

syntaxin binding protein 3

Synonyms: MUNC18-3 MUNC18C PSP UNC-18C
UniProtKB ID: O00186, A8K269, A8K5K7, Q53FW1, Q86YJ3, Q9UPD7
Gene ID:
Rat(114095) syntaxin binding protein 3
naked mole-rat(101720682) syntaxin binding protein 3
Domestic Rabbit(100342304) syntaxin binding protein 3
domestic guinea pig(100727174) syntaxin binding protein 3
cow(512490) syntaxin binding protein 3
sheep(101122397) syntaxin binding protein 3
Zebrafish(406780) syntaxin binding protein 3
chicken(424341) syntaxin binding protein 3
domestic cat(101087935) syntaxin binding protein 3
dog(490128) syntaxin binding protein 3
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007269 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033611 MISSION® esiRNA esiRNA human STXBP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007269 Rosetta Predictions human pricing
NM_053637 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210987 predicted 372
2 SASI_Hs01_00210990 predicted 1508
3 SASI_Hs01_00210991 predicted 1092
4 SASI_Hs01_00210992 predicted 1049
5 SASI_Hs01_00210993 predicted 1425
6 SASI_Hs02_00343314 predicted 1686
7 SASI_Hs02_00343315 predicted 1609
8 SASI_Hs01_00210994 predicted 682
9 SASI_Hs01_00210995 predicted 1602
10 SASI_Hs02_00343316 predicted 1875
11 SASI_Hs01_00210986 predicted 1591
12 SASI_Hs01_00210988 predicted 882
13 SASI_Hs01_00210989 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031289 predicted 1337
2 SASI_Rn01_00031290 predicted 1021
3 SASI_Rn01_00031291 predicted 335
4 SASI_Rn01_00031293 predicted 696
5 SASI_Rn01_00031294 predicted 1170
6 SASI_Rn01_00031295 predicted 1350
7 SASI_Rn01_00031296 predicted 1643
8 SASI_Rn01_00031297 predicted 1032
9 SASI_Rn02_00266358 predicted 1866
10 SASI_Rn01_00031298 predicted 534
11 SASI_Rn01_00031292 predicted 1829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007269
STXBP3 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-934s1c1
Sequence:CCGGCGACATATTGCGGTTGTGTTACTCGAGTAACACAACCGCAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1090s1c1
Sequence:CCGGCATCTTAACTTAGCAGAAGATCTCGAGATCTTCTGCTAAGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-299s1c1
Sequence:CCGGCGACATCAAAGTCTGTAGATTCTCGAGAATCTACAGACTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-693s1c1
Sequence:CCGGGCTTGAAGACTACTACAAGATCTCGAGATCTTGTAGTAGTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007269.1-2119s1c1
Sequence:CCGGGCCACCTATGTACATACTAATCTCGAGATTAGTATGTACATAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-476s1c1
Sequence:CCGGCACATGAATCTCAGGTGTATACTCGAGTATACACCTGAGATTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1796s1c1
Sequence:CCGGCCAAGGATAAAGTCTCCTTAACTCGAGTTAAGGAGACTTTATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1718s1c1
Sequence:CCGGCCTGTGAAGTTATTATTGGTTCTCGAGAACCAATAATAACTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007269
STXBP3 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-934s1c1
Sequence:CCGGCGACATATTGCGGTTGTGTTACTCGAGTAACACAACCGCAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1090s1c1
Sequence:CCGGCATCTTAACTTAGCAGAAGATCTCGAGATCTTCTGCTAAGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-299s1c1
Sequence:CCGGCGACATCAAAGTCTGTAGATTCTCGAGAATCTACAGACTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-693s1c1
Sequence:CCGGGCTTGAAGACTACTACAAGATCTCGAGATCTTGTAGTAGTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007269.1-2119s1c1
Sequence:CCGGGCCACCTATGTACATACTAATCTCGAGATTAGTATGTACATAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-476s1c1
Sequence:CCGGCACATGAATCTCAGGTGTATACTCGAGTATACACCTGAGATTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1796s1c1
Sequence:CCGGCCAAGGATAAAGTCTCCTTAACTCGAGTTAAGGAGACTTTATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1718s1c1
Sequence:CCGGCCTGTGAAGTTATTATTGGTTCTCGAGAACCAATAATAACTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007269
STXBP3 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-934s1c1
Sequence:CCGGCGACATATTGCGGTTGTGTTACTCGAGTAACACAACCGCAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1090s1c1
Sequence:CCGGCATCTTAACTTAGCAGAAGATCTCGAGATCTTCTGCTAAGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-299s1c1
Sequence:CCGGCGACATCAAAGTCTGTAGATTCTCGAGAATCTACAGACTTTGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-693s1c1
Sequence:CCGGGCTTGAAGACTACTACAAGATCTCGAGATCTTGTAGTAGTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007269.1-2119s1c1
Sequence:CCGGGCCACCTATGTACATACTAATCTCGAGATTAGTATGTACATAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007269.1-476s1c1
Sequence:CCGGCACATGAATCTCAGGTGTATACTCGAGTATACACCTGAGATTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1796s1c1
Sequence:CCGGCCAAGGATAAAGTCTCCTTAACTCGAGTTAAGGAGACTTTATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007269.1-1718s1c1
Sequence:CCGGCCTGTGAAGTTATTATTGGTTCTCGAGAACCAATAATAACTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks