EMAIL THIS PAGE TO A FRIEND

STXBP4

syntaxin binding protein 4

Synonyms: Synip
UniProtKB ID: Q6ZWJ1, Q8IVZ5
Gene ID:
Mouse(20913) syntaxin binding protein 4
Rat(303443) syntaxin binding protein 4
cow(537963) syntaxin binding protein 4
sheep(101118709) syntaxin binding protein 4
domestic guinea pig(100725018) syntaxin binding protein 4
naked mole-rat(101702027) syntaxin binding protein 4
chicken(417393) syntaxin binding protein 4
Horse(100056587) syntaxin binding protein 4
domestic cat(101086102) syntaxin binding protein 4
dog(491094) syntaxin binding protein 4
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178509 Rosetta Predictions human pricing
NM_001107038 Rosetta Predictions rat pricing
NM_011505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172431 predicted 929
2 SASI_Hs01_00172432 predicted 375
3 SASI_Hs02_00369751 predicted 1362
4 SASI_Hs01_00172434 predicted 399
5 SASI_Hs01_00172435 predicted 1323
6 SASI_Hs01_00172436 predicted 729
7 SASI_Hs01_00172437 predicted 429
8 SASI_Hs01_00172438 predicted 1900
9 SASI_Hs02_00369752 predicted 336
10 SASI_Hs02_00369753 predicted 1912
11 SASI_Hs01_00172433 predicted 1038
12 SASI_Hs01_00172439 predicted 556
13 SASI_Hs01_00172440 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224876 predicted 1006
2 SASI_Rn02_00224877 predicted 1375
3 SASI_Rn02_00224878 predicted 320
4 SASI_Rn02_00224879 predicted 1617
5 SASI_Rn02_00224880 predicted 660
6 SASI_Rn02_00224881 predicted 698
7 SASI_Rn02_00224882 predicted 755
8 SASI_Rn02_00224883 predicted 1064
9 SASI_Rn02_00224884 predicted 868
10 SASI_Rn02_00224885 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190932 predicted 1749
2 SASI_Mm02_00320812 predicted 837
3 SASI_Mm01_00190934 predicted 1525
4 SASI_Mm01_00190936 predicted 440
5 SASI_Mm01_00190938 predicted 382
6 SASI_Mm01_00190939 predicted 749
7 SASI_Mm01_00190940 predicted 1505
8 SASI_Mm01_00190941 predicted 769
9 SASI_Mm02_00320813 predicted 1485
10 SASI_Mm02_00320814 predicted 741
11 SASI_Mm01_00190933 predicted 1175
12 SASI_Mm01_00190935 predicted 520
13 SASI_Mm01_00190937 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178509
VALIDATED
STXBP4 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-759s21c1
Sequence:CCGGTACTGTGGGTTTGTCTAATACCTCGAGGTATTAGACAAACCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1426s21c1
Sequence:CCGGATGGTACTCGACTGCCAATTACTCGAGTAATTGGCAGTCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178509.5-1902s21c1
Sequence:CCGGGATGTGAGCAGAGACGCATAACTCGAGTTATGCGTCTCTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1022s21c1
Sequence:CCGGATGTTGGTGCACATGAAATTTCTCGAGAAATTTCATGTGCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-598s21c1
Sequence:CCGGGGACCTCAAGCCTCAACATTACTCGAGTAATGTTGAGGCTTGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1647s21c1
Sequence:CCGGTGAATCTAAGGAACTTGTTAACTCGAGTTAACAAGTTCCTTAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-833s21c1
Sequence:CCGGTAAATCCCTCTGTTCGCTTTACTCGAGTAAAGCGAACAGAGGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-536s1c1
Sequence:CCGGCCGACAACATTCAGCCAGAAACTCGAGTTTCTGGCTGAATGTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-1679s1c1
Sequence:CCGGCCTTACTTGATATGGATTGTTCTCGAGAACAATCCATATCAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-446s1c1
Sequence:CCGGGTGTATCATTTGAAGAAGCAACTCGAGTTGCTTCTTCAAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178509.5-3609s1c1
Sequence:CCGGCCGCCCTGTTTCTGTCAAATACTCGAGTATTTGACAGAAACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-505s1c1
Sequence:CCGGGCTTGGGAGATAGCATTCATACTCGAGTATGAATGCTATCTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178509
VALIDATED
STXBP4 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-759s21c1
Sequence:CCGGTACTGTGGGTTTGTCTAATACCTCGAGGTATTAGACAAACCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1426s21c1
Sequence:CCGGATGGTACTCGACTGCCAATTACTCGAGTAATTGGCAGTCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178509.5-1902s21c1
Sequence:CCGGGATGTGAGCAGAGACGCATAACTCGAGTTATGCGTCTCTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1022s21c1
Sequence:CCGGATGTTGGTGCACATGAAATTTCTCGAGAAATTTCATGTGCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-598s21c1
Sequence:CCGGGGACCTCAAGCCTCAACATTACTCGAGTAATGTTGAGGCTTGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1647s21c1
Sequence:CCGGTGAATCTAAGGAACTTGTTAACTCGAGTTAACAAGTTCCTTAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-833s21c1
Sequence:CCGGTAAATCCCTCTGTTCGCTTTACTCGAGTAAAGCGAACAGAGGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-536s1c1
Sequence:CCGGCCGACAACATTCAGCCAGAAACTCGAGTTTCTGGCTGAATGTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-1679s1c1
Sequence:CCGGCCTTACTTGATATGGATTGTTCTCGAGAACAATCCATATCAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-446s1c1
Sequence:CCGGGTGTATCATTTGAAGAAGCAACTCGAGTTGCTTCTTCAAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178509.5-3609s1c1
Sequence:CCGGCCGCCCTGTTTCTGTCAAATACTCGAGTATTTGACAGAAACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-505s1c1
Sequence:CCGGGCTTGGGAGATAGCATTCATACTCGAGTATGAATGCTATCTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178509
VALIDATED
STXBP4 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-759s21c1
Sequence:CCGGTACTGTGGGTTTGTCTAATACCTCGAGGTATTAGACAAACCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1426s21c1
Sequence:CCGGATGGTACTCGACTGCCAATTACTCGAGTAATTGGCAGTCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178509.5-1902s21c1
Sequence:CCGGGATGTGAGCAGAGACGCATAACTCGAGTTATGCGTCTCTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1022s21c1
Sequence:CCGGATGTTGGTGCACATGAAATTTCTCGAGAAATTTCATGTGCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-598s21c1
Sequence:CCGGGGACCTCAAGCCTCAACATTACTCGAGTAATGTTGAGGCTTGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-1647s21c1
Sequence:CCGGTGAATCTAAGGAACTTGTTAACTCGAGTTAACAAGTTCCTTAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178509.5-833s21c1
Sequence:CCGGTAAATCCCTCTGTTCGCTTTACTCGAGTAAAGCGAACAGAGGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-536s1c1
Sequence:CCGGCCGACAACATTCAGCCAGAAACTCGAGTTTCTGGCTGAATGTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-1679s1c1
Sequence:CCGGCCTTACTTGATATGGATTGTTCTCGAGAACAATCCATATCAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178509.5-446s1c1
Sequence:CCGGGTGTATCATTTGAAGAAGCAACTCGAGTTGCTTCTTCAAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178509.5-3609s1c1
Sequence:CCGGCCGCCCTGTTTCTGTCAAATACTCGAGTATTTGACAGAAACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_178509.5-505s1c1
Sequence:CCGGGCTTGGGAGATAGCATTCATACTCGAGTATGAATGCTATCTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011505
VALIDATED
STXBP4 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-427s21c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-277s21c1
Sequence:CCGGATCCTGCCTTTCGGGTGATTACTCGAGTAATCACCCGAAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1393s21c1
Sequence:CCGGAGGCTCAGCTCGCTGATTATTCTCGAGAATAATCAGCGAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-615s21c1
Sequence:CCGGGGACCTCAAACCTCAACATTTCTCGAGAAATGTTGAGGTTTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-2182s21c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1330s21c1
Sequence:GTACCGGACGGGATGGAAATGGATTATGCTCGAGCATAATCCATTTCCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-352s21c1
Sequence:GTACCGGATGAAGGACCGCTGGTGTATACTCGAGTATACACCAGCGGTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-2172s1c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-785s1c1
Sequence:CCGGGATACATCTAATGCAGACATTCTCGAGAATGTCTGCATTAGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-350s1c1
Sequence:CCGGCCGCTGGTGTATATTCATGAACTCGAGTTCATGAATATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-920s1c1
Sequence:CCGGCCAACAAAGGAACAACGTGAACTCGAGTTCACGTTGTTCCTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-417s1c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011505
VALIDATED
STXBP4 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-427s21c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-277s21c1
Sequence:CCGGATCCTGCCTTTCGGGTGATTACTCGAGTAATCACCCGAAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1393s21c1
Sequence:CCGGAGGCTCAGCTCGCTGATTATTCTCGAGAATAATCAGCGAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-615s21c1
Sequence:CCGGGGACCTCAAACCTCAACATTTCTCGAGAAATGTTGAGGTTTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-2182s21c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1330s21c1
Sequence:GTACCGGACGGGATGGAAATGGATTATGCTCGAGCATAATCCATTTCCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-352s21c1
Sequence:GTACCGGATGAAGGACCGCTGGTGTATACTCGAGTATACACCAGCGGTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-2172s1c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-785s1c1
Sequence:CCGGGATACATCTAATGCAGACATTCTCGAGAATGTCTGCATTAGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-350s1c1
Sequence:CCGGCCGCTGGTGTATATTCATGAACTCGAGTTCATGAATATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-920s1c1
Sequence:CCGGCCAACAAAGGAACAACGTGAACTCGAGTTCACGTTGTTCCTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-417s1c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011505
VALIDATED
STXBP4 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-427s21c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-277s21c1
Sequence:CCGGATCCTGCCTTTCGGGTGATTACTCGAGTAATCACCCGAAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1393s21c1
Sequence:CCGGAGGCTCAGCTCGCTGATTATTCTCGAGAATAATCAGCGAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-615s21c1
Sequence:CCGGGGACCTCAAACCTCAACATTTCTCGAGAAATGTTGAGGTTTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011505.2-2182s21c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-1330s21c1
Sequence:GTACCGGACGGGATGGAAATGGATTATGCTCGAGCATAATCCATTTCCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011505.2-352s21c1
Sequence:GTACCGGATGAAGGACCGCTGGTGTATACTCGAGTATACACCAGCGGTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-2172s1c1
Sequence:CCGGGCTCATTGTTTGGTATGAGATCTCGAGATCTCATACCAAACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-785s1c1
Sequence:CCGGGATACATCTAATGCAGACATTCTCGAGAATGTCTGCATTAGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-350s1c1
Sequence:CCGGCCGCTGGTGTATATTCATGAACTCGAGTTCATGAATATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011505.1-920s1c1
Sequence:CCGGCCAACAAAGGAACAACGTGAACTCGAGTTCACGTTGTTCCTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011505.1-417s1c1
Sequence:CCGGGAGATCAACTTGTCTCAATAACTCGAGTTATTGAGACAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks