EMAIL THIS PAGE TO A FRIEND

STXBP5

syntaxin binding protein 5 (tomosyn)

Synonyms: LGL3 LLGL3 Nbla04300
UniProtKB ID: Q5T5C0, Q14DF3, Q5T5C1, Q5T5C2, Q8NBG8, Q96NG9
Gene ID:
Human(134957) Summary: Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(78808) syntaxin binding protein 5 (tomosyn)
Rat(81022) syntaxin binding protein 5 (tomosyn)
chicken(421620) syntaxin binding protein 5 (tomosyn)
domestic cat(101080457) syntaxin binding protein 5 (tomosyn)
dog(476237) syntaxin binding protein 5 (tomosyn)
naked mole-rat(101700958) syntaxin binding protein 5 (tomosyn)
Domestic Rabbit(100356721) syntaxin binding protein 5 (tomosyn)
domestic guinea pig(100719857) syntaxin binding protein 5 (tomosyn)
cow(537603) syntaxin binding protein 5 (tomosyn)
sheep(101121429) syntaxin binding protein 5 (tomosyn)
288 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127715 Rosetta Predictions human pricing
NM_139244 Rosetta Predictions human pricing
NM_030843 Rosetta Predictions rat pricing
NM_178345 Rosetta Predictions rat pricing
NM_178346 Rosetta Predictions rat pricing
NM_001081344 Rosetta Predictions mouse pricing
XM_125517 Rosetta Predictions mouse pricing
XM_896347 Rosetta Predictions mouse pricing
XM_896361 Rosetta Predictions mouse pricing
XM_896376 Rosetta Predictions mouse pricing
XM_896388 Rosetta Predictions mouse pricing
XM_896398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330344 predicted 1903
2 SASI_Hs02_00330345 predicted 1780
3 SASI_Hs02_00330346 predicted 858
4 SASI_Hs02_00330347 predicted 1926
5 SASI_Hs02_00330348 predicted 2096
6 SASI_Hs02_00330349 predicted 1977
7 SASI_Hs02_00330350 predicted 3138
8 SASI_Hs02_00330351 predicted 1174
9 SASI_Hs02_00330352 predicted 2550
10 SASI_Hs02_00330353 predicted 3693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112454 predicted 2218
2 SASI_Hs01_00112455 predicted 2092
3 SASI_Hs01_00112456 predicted 1170
4 SASI_Hs01_00112457 predicted 2231
5 SASI_Hs01_00112460 predicted 2408
6 SASI_Hs02_00364247 predicted 2290
7 SASI_Hs01_00112461 predicted 3344
8 SASI_Hs01_00112462 predicted 1483
9 SASI_Hs02_00364248 predicted 2760
10 SASI_Hs01_00112463 predicted 3898
11 SASI_Hs01_00112458 predicted 2656
12 SASI_Hs01_00112459 predicted 2956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120799 predicted 1108
2 SASI_Rn01_00120800 predicted 1581
3 SASI_Rn02_00264071 predicted 1472
4 SASI_Rn01_00120801 predicted 1754
5 SASI_Rn01_00120802 predicted 2124
6 SASI_Rn01_00120803 predicted 3403
7 SASI_Rn01_00120805 predicted 1123
8 SASI_Rn01_00120806 predicted 903
9 SASI_Rn01_00120807 predicted 1052
10 SASI_Rn02_00264072 predicted 955
11 SASI_Rn01_00120804 predicted 1406
12 SASI_Rn01_00120808 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047628 predicted 763
2 SASI_Rn01_00047629 predicted 1231
3 SASI_Rn02_00269643 predicted 1116
4 SASI_Rn01_00047630 predicted 1408
5 SASI_Rn01_00047631 predicted 1776
6 SASI_Rn01_00047632 predicted 3167
7 SASI_Rn01_00047634 predicted 768
8 SASI_Rn01_00047635 predicted 558
9 SASI_Rn01_00047636 predicted 698
10 SASI_Rn02_00269644 predicted 600
11 SASI_Rn01_00047633 predicted 1058
12 SASI_Rn01_00047637 predicted 2554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077163 predicted 766
2 SASI_Rn01_00077164 predicted 1233
3 SASI_Rn02_00269645 predicted 1124
4 SASI_Rn01_00077165 predicted 1410
5 SASI_Rn01_00077166 predicted 1776
6 SASI_Rn01_00077167 predicted 3004
7 SASI_Rn01_00077169 predicted 773
8 SASI_Rn01_00077170 predicted 560
9 SASI_Rn01_00077171 predicted 705
10 SASI_Rn02_00269646 predicted 598
11 SASI_Rn01_00077168 predicted 1058
12 SASI_Rn01_00077172 predicted 2395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297491 predicted 945
2 SASI_Mm02_00297492 predicted 1442
3 SASI_Mm02_00297493 predicted 2789
4 SASI_Mm02_00297494 predicted 3144
5 SASI_Mm02_00297495 predicted 847
6 SASI_Mm02_00297496 predicted 3255
7 SASI_Mm02_00297497 predicted 1130
8 SASI_Mm02_00297498 predicted 1055
9 SASI_Mm02_00297499 predicted 3378
10 SASI_Mm02_00297500 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202812 predicted 594
2 SASI_Mm01_00202813 predicted 1092
3 SASI_Mm01_00202814 predicted 2551
4 SASI_Mm01_00202815 predicted 2897
5 SASI_Mm01_00202816 predicted 1771
6 SASI_Mm01_00202817 predicted 497
7 SASI_Mm01_00202818 predicted 3017
8 SASI_Mm01_00202819 predicted 778
9 SASI_Mm01_00202820 predicted 709
10 SASI_Mm01_00202821 predicted 3127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203178 predicted 597
2 SASI_Mm01_00203179 predicted 1086
3 SASI_Mm01_00203180 predicted 2440
4 SASI_Mm01_00203181 predicted 2791
5 SASI_Mm01_00203182 predicted 1768
6 SASI_Mm01_00203183 predicted 490
7 SASI_Mm01_00203184 predicted 2904
8 SASI_Mm01_00203185 predicted 784
9 SASI_Mm01_00203186 predicted 703
10 SASI_Mm01_00203187 predicted 3018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238420 predicted 2605
2 SASI_Mm01_00238421 predicted 3001
3 SASI_Mm01_00238422 predicted 2545
4 SASI_Mm01_00238423 predicted 2898
5 SASI_Mm01_00238424 predicted 3017
6 SASI_Mm01_00238425 predicted 3477
7 SASI_Mm01_00238426 predicted 3126
8 SASI_Mm01_00238427 predicted 2275
9 SASI_Mm01_00238428 predicted 2470
10 SASI_Mm01_00238429 predicted 2716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228519 predicted 694
2 SASI_Mm01_00228520 predicted 1093
3 SASI_Mm01_00228521 predicted 496
4 SASI_Mm01_00228522 predicted 440
5 SASI_Mm01_00228523 predicted 615
6 SASI_Mm01_00228524 predicted 722
7 SASI_Mm01_00228525 predicted 931
8 SASI_Mm01_00228526 predicted 1015
9 SASI_Mm01_00228527 predicted 771
10 SASI_Mm01_00228528 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258938 predicted 598
2 SASI_Mm01_00258939 predicted 1093
3 SASI_Mm01_00258940 predicted 2555
4 SASI_Mm01_00258941 predicted 2907
5 SASI_Mm01_00258942 predicted 1766
6 SASI_Mm01_00258943 predicted 498
7 SASI_Mm01_00258944 predicted 3020
8 SASI_Mm01_00258945 predicted 782
9 SASI_Mm01_00258946 predicted 703
10 SASI_Mm01_00258947 predicted 3142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251145 predicted 598
2 SASI_Mm01_00251146 predicted 984
3 SASI_Mm01_00251147 predicted 535
4 SASI_Mm01_00251148 predicted 889
5 SASI_Mm01_00251149 predicted 1004
6 SASI_Mm01_00251150 predicted 1464
7 SASI_Mm01_00251151 predicted 255
8 SASI_Mm01_00251152 predicted 1113
9 SASI_Mm01_00251153 predicted 465
10 SASI_Mm01_00251154 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139244
VALIDATED
STXBP5 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 5 (tomosyn)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-3283s1c1
Sequence:CCGGGCCAAGTTTAAGACCTCTGTTCTCGAGAACAGAGGTCTTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3072s1c1
Sequence:CCGGCCTCCTCTTCTCAGGAAATTACTCGAGTAATTTCCTGAGAAGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-2303s1c1
Sequence:CCGGCCAGGTTATCAAACAGAACTACTCGAGTAGTTCTGTTTGATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-4122s1c1
Sequence:CCGGCCTGGATCATTCCTGTATTAACTCGAGTTAATACAGGAATGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3530s1c1
Sequence:CCGGGCACAATCTCTTGACAGAGAACTCGAGTTCTCTGTCAAGAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3942s21c1
Sequence:CCGGGTCATTGGACTGGATTATAAACTCGAGTTTATAATCCAGTCCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1784s21c1
Sequence:CCGGGATGCTTGAAGTTCGATTATTCTCGAGAATAATCGAACTTCAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3576s21c1
Sequence:CCGGTTAGGAAAGTTAACGTTAAAGCTCGAGCTTTAACGTTAACTTTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-3277s21c1
Sequence:CCGGGGAGCCTTGCACAGCATATTCCTCGAGGAATATGCTGTGCAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3687s21c1
Sequence:CCGGGCACTCGAAATGGAGTATATGCTCGAGCATATACTCCATTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-638s21c1
Sequence:CCGGGGGCACTGAACGAGGTAATATCTCGAGATATTACCTCGTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1559s21c1
Sequence:CCGGTGCAATAACTCTACAAGTATTCTCGAGAATACTTGTAGAGTTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139244
VALIDATED
STXBP5 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 5 (tomosyn)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-3283s1c1
Sequence:CCGGGCCAAGTTTAAGACCTCTGTTCTCGAGAACAGAGGTCTTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3072s1c1
Sequence:CCGGCCTCCTCTTCTCAGGAAATTACTCGAGTAATTTCCTGAGAAGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-2303s1c1
Sequence:CCGGCCAGGTTATCAAACAGAACTACTCGAGTAGTTCTGTTTGATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-4122s1c1
Sequence:CCGGCCTGGATCATTCCTGTATTAACTCGAGTTAATACAGGAATGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3530s1c1
Sequence:CCGGGCACAATCTCTTGACAGAGAACTCGAGTTCTCTGTCAAGAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3942s21c1
Sequence:CCGGGTCATTGGACTGGATTATAAACTCGAGTTTATAATCCAGTCCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1784s21c1
Sequence:CCGGGATGCTTGAAGTTCGATTATTCTCGAGAATAATCGAACTTCAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3576s21c1
Sequence:CCGGTTAGGAAAGTTAACGTTAAAGCTCGAGCTTTAACGTTAACTTTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-3277s21c1
Sequence:CCGGGGAGCCTTGCACAGCATATTCCTCGAGGAATATGCTGTGCAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3687s21c1
Sequence:CCGGGCACTCGAAATGGAGTATATGCTCGAGCATATACTCCATTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-638s21c1
Sequence:CCGGGGGCACTGAACGAGGTAATATCTCGAGATATTACCTCGTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1559s21c1
Sequence:CCGGTGCAATAACTCTACAAGTATTCTCGAGAATACTTGTAGAGTTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139244
VALIDATED
STXBP5 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 5 (tomosyn)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-3283s1c1
Sequence:CCGGGCCAAGTTTAAGACCTCTGTTCTCGAGAACAGAGGTCTTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3072s1c1
Sequence:CCGGCCTCCTCTTCTCAGGAAATTACTCGAGTAATTTCCTGAGAAGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139244.2-2303s1c1
Sequence:CCGGCCAGGTTATCAAACAGAACTACTCGAGTAGTTCTGTTTGATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-4122s1c1
Sequence:CCGGCCTGGATCATTCCTGTATTAACTCGAGTTAATACAGGAATGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139244.2-3530s1c1
Sequence:CCGGGCACAATCTCTTGACAGAGAACTCGAGTTCTCTGTCAAGAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3942s21c1
Sequence:CCGGGTCATTGGACTGGATTATAAACTCGAGTTTATAATCCAGTCCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1784s21c1
Sequence:CCGGGATGCTTGAAGTTCGATTATTCTCGAGAATAATCGAACTTCAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3576s21c1
Sequence:CCGGTTAGGAAAGTTAACGTTAAAGCTCGAGCTTTAACGTTAACTTTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-3277s21c1
Sequence:CCGGGGAGCCTTGCACAGCATATTCCTCGAGGAATATGCTGTGCAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139244.3-3687s21c1
Sequence:CCGGGCACTCGAAATGGAGTATATGCTCGAGCATATACTCCATTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-638s21c1
Sequence:CCGGGGGCACTGAACGAGGTAATATCTCGAGATATTACCTCGTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139244.3-1559s21c1
Sequence:CCGGTGCAATAACTCTACAAGTATTCTCGAGAATACTTGTAGAGTTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081344
VALIDATED
STXBP5 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 5 (tomosyn)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081344.2-2796s21c1
Sequence:CCGGCGGTACTATATTGAGGTTAAACTCGAGTTTAACCTCAATATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-1724s21c1
Sequence:CCGGATGCTGATGGCTCGGTGAAATCTCGAGATTTCACCGAGCCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081344.2-6712s21c1
Sequence:CCGGTTCGCATGTGACATTAGTAAACTCGAGTTTACTAATGTCACATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2127s21c1
Sequence:CCGGATCTGACGGGCTTCGTGATAACTCGAGTTATCACGAAGCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2365s21c1
Sequence:CCGGATCGAACTTTACGGCTCAAATCTCGAGATTTGAGCCGTAAAGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081344
VALIDATED
STXBP5 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 5 (tomosyn)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081344.2-2796s21c1
Sequence:CCGGCGGTACTATATTGAGGTTAAACTCGAGTTTAACCTCAATATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-1724s21c1
Sequence:CCGGATGCTGATGGCTCGGTGAAATCTCGAGATTTCACCGAGCCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081344.2-6712s21c1
Sequence:CCGGTTCGCATGTGACATTAGTAAACTCGAGTTTACTAATGTCACATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2127s21c1
Sequence:CCGGATCTGACGGGCTTCGTGATAACTCGAGTTATCACGAAGCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2365s21c1
Sequence:CCGGATCGAACTTTACGGCTCAAATCTCGAGATTTGAGCCGTAAAGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081344
VALIDATED
STXBP5 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 5 (tomosyn)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081344.2-2796s21c1
Sequence:CCGGCGGTACTATATTGAGGTTAAACTCGAGTTTAACCTCAATATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-1724s21c1
Sequence:CCGGATGCTGATGGCTCGGTGAAATCTCGAGATTTCACCGAGCCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081344.2-6712s21c1
Sequence:CCGGTTCGCATGTGACATTAGTAAACTCGAGTTTACTAATGTCACATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2127s21c1
Sequence:CCGGATCTGACGGGCTTCGTGATAACTCGAGTTATCACGAAGCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081344.2-2365s21c1
Sequence:CCGGATCGAACTTTACGGCTCAAATCTCGAGATTTGAGCCGTAAAGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks