EMAIL THIS PAGE TO A FRIEND

STXBP5L

syntaxin binding protein 5-like

Synonyms: LLGL4
UniProtKB ID: Q9Y2K9, Q4G1B4, Q6PIC3
Gene ID:
Mouse(207227) syntaxin binding protein 5-like
Rat(288080) syntaxin binding protein 5-like
Zebrafish(567605) syntaxin binding protein 5-like
Horse(100070790) syntaxin binding protein 5-like
domestic cat(101083792) syntaxin binding protein 5-like
chicken(418327) syntaxin binding protein 5-like
dog(100684760) syntaxin binding protein 5-like
cow(536735) syntaxin binding protein 5-like
sheep(101109405) syntaxin binding protein 5-like
domestic guinea pig(100721606) syntaxin binding protein 5-like
naked mole-rat(101724698) syntaxin binding protein 5-like
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041831 MISSION® esiRNA esiRNA human STXBP5L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014980 Rosetta Predictions human pricing
XM_045911 Rosetta Predictions human pricing
XM_001070379 Rosetta Predictions rat pricing
XM_221424 Rosetta Predictions rat pricing
NM_001114611 Rosetta Predictions mouse pricing
NM_001114612 Rosetta Predictions mouse pricing
NM_001114613 Rosetta Predictions mouse pricing
NM_172440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346701 predicted 2789
2 SASI_Hs02_00346702 predicted 1390
3 SASI_Hs02_00346703 predicted 581
4 SASI_Hs02_00346704 predicted 2668
5 SASI_Hs02_00346705 predicted 1399
6 SASI_Hs02_00346706 predicted 2933
7 SASI_Hs02_00346707 predicted 3322
8 SASI_Hs02_00346708 predicted 2574
9 SASI_Hs02_00346709 predicted 2173
10 SASI_Hs02_00346710 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_045911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251362 predicted 870
2 SASI_Hs01_00251363 predicted 827
3 SASI_Hs01_00251364 predicted 824
4 SASI_Hs01_00251365 predicted 827
5 SASI_Hs01_00251366 predicted 840
6 SASI_Hs01_00251367 predicted 855
7 SASI_Hs01_00251368 predicted 875
8 SASI_Hs01_00251369 predicted 853
9 SASI_Hs01_00251370 predicted 816
10 SASI_Hs01_00251371 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331446 predicted 3311
2 SASI_Rn02_00331447 predicted 2210
3 SASI_Rn02_00331448 predicted 3205
4 SASI_Rn02_00331449 predicted 984
5 SASI_Rn02_00331450 predicted 1835
6 SASI_Rn02_00331451 predicted 814
7 SASI_Rn02_00331452 predicted 1524
8 SASI_Rn02_00331453 predicted 1415
9 SASI_Rn02_00331454 predicted 2363
10 SASI_Rn02_00331455 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380105 predicted 3318
2 SASI_Rn02_00380106 predicted 2218
3 SASI_Rn02_00380107 predicted 3198
4 SASI_Rn02_00380108 predicted 984
5 SASI_Rn02_00380109 predicted 2845
6 SASI_Rn02_00380110 predicted 1842
7 SASI_Rn02_00380111 predicted 811
8 SASI_Rn02_00380112 predicted 1523
9 SASI_Rn02_00380113 predicted 1414
10 SASI_Rn02_00380114 predicted 2364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308717 predicted 3103
2 SASI_Mm02_00308718 predicted 957
3 SASI_Mm02_00308719 predicted 776
4 SASI_Mm02_00308720 predicted 1794
5 SASI_Mm02_00308721 predicted 2707
6 SASI_Mm02_00308722 predicted 1805
7 SASI_Mm02_00308723 predicted 1929
8 SASI_Mm02_00308724 predicted 671
9 SASI_Mm02_00308725 predicted 1419
10 SASI_Mm02_00308726 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308727 predicted 3269
2 SASI_Mm02_00308728 predicted 959
3 SASI_Mm02_00308729 predicted 773
4 SASI_Mm02_00308730 predicted 1790
5 SASI_Mm02_00308731 predicted 2881
6 SASI_Mm02_00308732 predicted 1805
7 SASI_Mm02_00308733 predicted 1931
8 SASI_Mm02_00308734 predicted 674
9 SASI_Mm02_00308735 predicted 1420
10 SASI_Mm02_00308736 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308737 predicted 3170
2 SASI_Mm02_00308738 predicted 952
3 SASI_Mm02_00308739 predicted 776
4 SASI_Mm02_00308740 predicted 1793
5 SASI_Mm02_00308741 predicted 2773
6 SASI_Mm02_00308742 predicted 1812
7 SASI_Mm02_00308743 predicted 1929
8 SASI_Mm02_00308744 predicted 674
9 SASI_Mm02_00308745 predicted 1413
10 SASI_Mm02_00308746 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343928 predicted 3346
2 SASI_Mm01_00142348 predicted 955
3 SASI_Mm01_00142349 predicted 782
4 SASI_Mm01_00142350 predicted 1789
5 SASI_Mm02_00343929 predicted 2944
6 SASI_Mm01_00142353 predicted 1806
7 SASI_Mm01_00142354 predicted 1926
8 SASI_Mm02_00343930 predicted 677
9 SASI_Mm01_00142355 predicted 1416
10 SASI_Mm01_00142356 predicted 1184
11 SASI_Mm01_00142347 predicted 2541
12 SASI_Mm01_00142351 predicted 2233
13 SASI_Mm01_00142352 predicted 2156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014980
STXBP5L MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 5-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-1539s21c1
Sequence:CCGGGGTCATGCAGATGGATCAATACTCGAGTATTGATCCATCTGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014980.2-5929s21c1
Sequence:CCGGACTTGATCTACATCGAGATTTCTCGAGAAATCTCGATGTAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3242s21c1
Sequence:CCGGCAATGAAGGACAGGCATTATACTCGAGTATAATGCCTGTCCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-2846s21c1
Sequence:CCGGGGACCGAATGGGTGGATTAATCTCGAGATTAATCCACCCATTCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3213s21c1
Sequence:CCGGATGAGGATAGCACGAACATTTCTCGAGAAATGTTCGTGCTATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014980
STXBP5L MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 5-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-1539s21c1
Sequence:CCGGGGTCATGCAGATGGATCAATACTCGAGTATTGATCCATCTGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014980.2-5929s21c1
Sequence:CCGGACTTGATCTACATCGAGATTTCTCGAGAAATCTCGATGTAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3242s21c1
Sequence:CCGGCAATGAAGGACAGGCATTATACTCGAGTATAATGCCTGTCCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-2846s21c1
Sequence:CCGGGGACCGAATGGGTGGATTAATCTCGAGATTAATCCACCCATTCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3213s21c1
Sequence:CCGGATGAGGATAGCACGAACATTTCTCGAGAAATGTTCGTGCTATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014980
STXBP5L MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 5-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-1539s21c1
Sequence:CCGGGGTCATGCAGATGGATCAATACTCGAGTATTGATCCATCTGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014980.2-5929s21c1
Sequence:CCGGACTTGATCTACATCGAGATTTCTCGAGAAATCTCGATGTAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3242s21c1
Sequence:CCGGCAATGAAGGACAGGCATTATACTCGAGTATAATGCCTGTCCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-2846s21c1
Sequence:CCGGGGACCGAATGGGTGGATTAATCTCGAGATTAATCCACCCATTCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014980.2-3213s21c1
Sequence:CCGGATGAGGATAGCACGAACATTTCTCGAGAAATGTTCGTGCTATCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172440
STXBP5L MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 5-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172440.1-3154s1c1
Sequence:CCGGCCTGATATGGTGTTTCACTATCTCGAGATAGTGAAACACCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-1384s1c1
Sequence:CCGGCCTCCAGATTTGATTCTAGTACTCGAGTACTAGAATCAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2287s1c1
Sequence:CCGGCCCACCTCAGACCATGTAAATCTCGAGATTTACATGGTCTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2782s1c1
Sequence:CCGGCCATACGAAGTATGGAGAGATCTCGAGATCTCTCCATACTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-589s1c1
Sequence:CCGGCGAATTACTTACTGTCATCTACTCGAGTAGATGACAGTAAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172440
STXBP5L MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 5-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172440.1-3154s1c1
Sequence:CCGGCCTGATATGGTGTTTCACTATCTCGAGATAGTGAAACACCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-1384s1c1
Sequence:CCGGCCTCCAGATTTGATTCTAGTACTCGAGTACTAGAATCAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2287s1c1
Sequence:CCGGCCCACCTCAGACCATGTAAATCTCGAGATTTACATGGTCTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2782s1c1
Sequence:CCGGCCATACGAAGTATGGAGAGATCTCGAGATCTCTCCATACTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-589s1c1
Sequence:CCGGCGAATTACTTACTGTCATCTACTCGAGTAGATGACAGTAAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172440
STXBP5L MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 5-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172440.1-3154s1c1
Sequence:CCGGCCTGATATGGTGTTTCACTATCTCGAGATAGTGAAACACCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-1384s1c1
Sequence:CCGGCCTCCAGATTTGATTCTAGTACTCGAGTACTAGAATCAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2287s1c1
Sequence:CCGGCCCACCTCAGACCATGTAAATCTCGAGATTTACATGGTCTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-2782s1c1
Sequence:CCGGCCATACGAAGTATGGAGAGATCTCGAGATCTCTCCATACTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172440.1-589s1c1
Sequence:CCGGCGAATTACTTACTGTCATCTACTCGAGTAGATGACAGTAAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks