EMAIL THIS PAGE TO A FRIEND

STXBP6

syntaxin binding protein 6 (amisyn)

Synonyms: amisyn
UniProtKB ID: Q8NFX7, D3DS78, Q8N3H1, Q8N8D5, Q96GF3, Q9P008
Gene ID:
Human(29091) Summary: STXBP6 binds components of the SNARE complex (see MIM 603215) and may be involved in regulating SNARE complex formation (Scales et al., 2002 [PubMed 12145319]
Mouse(217517) syntaxin binding protein 6 (amisyn)
Rat(362734) syntaxin binding protein 6 (amisyn)
naked mole-rat(101711634) syntaxin binding protein 6 (amisyn)
domestic guinea pig(100712803) syntaxin binding protein 6 (amisyn)
cow(534718) syntaxin binding protein 6 (amisyn)
sheep(101113888) syntaxin binding protein 6 (amisyn)
Zebrafish(415153) syntaxin binding protein 6 (amisyn)
chicken(423299) syntaxin binding protein 6 (amisyn)
dog(608615) syntaxin binding protein 6 (amisyn)
domestic cat(101099724) syntaxin binding protein 6 (amisyn)
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014178 Rosetta Predictions human pricing
XM_001078123 Rosetta Predictions rat pricing
XM_343057 Rosetta Predictions rat pricing
NM_144552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028818 predicted 925
2 SASI_Hs01_00028819 predicted 1220
3 SASI_Hs01_00028820 predicted 831
4 SASI_Hs02_00345191 predicted 1156
5 SASI_Hs01_00028821 predicted 1692
6 SASI_Hs01_00028822 predicted 817
7 SASI_Hs01_00028823 predicted 1116
8 SASI_Hs01_00028824 predicted 746
9 SASI_Hs01_00028825 predicted 1688
10 SASI_Hs01_00028826 predicted 913
11 SASI_Hs01_00028827 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359713 predicted 752
2 SASI_Rn02_00359714 predicted 617
3 SASI_Rn02_00359715 predicted 767
4 SASI_Rn02_00359716 predicted 682
5 SASI_Rn02_00359717 predicted 679
6 SASI_Rn02_00359718 predicted 669
7 SASI_Rn02_00359719 predicted 509
8 SASI_Rn02_00359720 predicted 489
9 SASI_Rn02_00359721 predicted 978
10 SASI_Rn02_00359722 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395231 predicted 206
2 SASI_Rn02_00395232 predicted 336
3 SASI_Rn02_00395233 predicted 234
4 SASI_Rn02_00395234 predicted 242
5 SASI_Rn02_00395235 predicted 249
6 SASI_Rn02_00395236 predicted 245
7 SASI_Rn02_00395237 predicted 200
8 SASI_Rn02_00395238 predicted 337
9 SASI_Rn02_00395239 predicted 754
10 SASI_Rn02_00395240 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147422 predicted 329
2 SASI_Mm01_00147424 predicted 802
3 SASI_Mm01_00147425 predicted 787
4 SASI_Mm01_00147426 predicted 588
5 SASI_Mm01_00147427 predicted 502
6 SASI_Mm01_00147428 predicted 495
7 SASI_Mm02_00340090 predicted 722
8 SASI_Mm01_00147429 predicted 501
9 SASI_Mm01_00147430 predicted 338
10 SASI_Mm01_00147431 predicted 600
11 SASI_Mm01_00147423 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144552
STXBP6 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 6 (amisyn)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-498s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-462s1c1
Sequence:CCGGCGCCAAGTTAATGGTATTGATCTCGAGATCAATACCATTAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-876s1c1
Sequence:CCGGGAGGAGTTTGTTCAGCAGTTACTCGAGTAACTGCTGAACAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-327s1c1
Sequence:CCGGCAAGGCGAATACTTAACTTATCTCGAGATAAGTTAAGTATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-1131s1c1
Sequence:CCGGCTTGCTAAAGAATGCTGCAATCTCGAGATTGCAGCATTCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-384s1c1
Sequence:CCGGGCATCTATCACGAAGGTCAAACTCGAGTTTGACCTTCGTGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-394s1c1
Sequence:CCGGCAAGTCAAGAGAAGGACAAAGCTCGAGCTTTGTCCTTCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-730s1c1
Sequence:CCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-933s1c1
Sequence:CCGGGCTTGCCATGAAGCATAAATGCTCGAGCATTTATGCTTCATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1429s21c1
Sequence:GTACCGGTGTAGTTCAAATACGAAATTCCTCGAGGAATTTCGTATTTGAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-503s21c1
Sequence:GTACCGGCATCTATCACGAAGGTCAAACCTCGAGGTTTGACCTTCGTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-570s21c1
Sequence:GTACCGGTGAGCAGCTTCGCCAAGTTAACTCGAGTTAACTTGGCGAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-932s21c1
Sequence:GTACCGGAGCTTGCCATGAAGCATAAATCTCGAGATTTATGCTTCATGGCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1229s21c1
Sequence:GTACCGGAGCATGCTGTGGGCATATATTCTCGAGAATATATGCCCACAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144552
STXBP6 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 6 (amisyn)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-498s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-462s1c1
Sequence:CCGGCGCCAAGTTAATGGTATTGATCTCGAGATCAATACCATTAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-876s1c1
Sequence:CCGGGAGGAGTTTGTTCAGCAGTTACTCGAGTAACTGCTGAACAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-327s1c1
Sequence:CCGGCAAGGCGAATACTTAACTTATCTCGAGATAAGTTAAGTATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-1131s1c1
Sequence:CCGGCTTGCTAAAGAATGCTGCAATCTCGAGATTGCAGCATTCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-384s1c1
Sequence:CCGGGCATCTATCACGAAGGTCAAACTCGAGTTTGACCTTCGTGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-394s1c1
Sequence:CCGGCAAGTCAAGAGAAGGACAAAGCTCGAGCTTTGTCCTTCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-730s1c1
Sequence:CCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-933s1c1
Sequence:CCGGGCTTGCCATGAAGCATAAATGCTCGAGCATTTATGCTTCATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1429s21c1
Sequence:GTACCGGTGTAGTTCAAATACGAAATTCCTCGAGGAATTTCGTATTTGAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-503s21c1
Sequence:GTACCGGCATCTATCACGAAGGTCAAACCTCGAGGTTTGACCTTCGTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-570s21c1
Sequence:GTACCGGTGAGCAGCTTCGCCAAGTTAACTCGAGTTAACTTGGCGAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-932s21c1
Sequence:GTACCGGAGCTTGCCATGAAGCATAAATCTCGAGATTTATGCTTCATGGCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1229s21c1
Sequence:GTACCGGAGCATGCTGTGGGCATATATTCTCGAGAATATATGCCCACAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144552
STXBP6 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 6 (amisyn)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-498s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.1-462s1c1
Sequence:CCGGCGCCAAGTTAATGGTATTGATCTCGAGATCAATACCATTAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-876s1c1
Sequence:CCGGGAGGAGTTTGTTCAGCAGTTACTCGAGTAACTGCTGAACAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-327s1c1
Sequence:CCGGCAAGGCGAATACTTAACTTATCTCGAGATAAGTTAAGTATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144552.1-1131s1c1
Sequence:CCGGCTTGCTAAAGAATGCTGCAATCTCGAGATTGCAGCATTCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144552.1-384s1c1
Sequence:CCGGGCATCTATCACGAAGGTCAAACTCGAGTTTGACCTTCGTGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-394s1c1
Sequence:CCGGCAAGTCAAGAGAAGGACAAAGCTCGAGCTTTGTCCTTCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-730s1c1
Sequence:CCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144552.3-933s1c1
Sequence:CCGGGCTTGCCATGAAGCATAAATGCTCGAGCATTTATGCTTCATGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1429s21c1
Sequence:GTACCGGTGTAGTTCAAATACGAAATTCCTCGAGGAATTTCGTATTTGAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-503s21c1
Sequence:GTACCGGCATCTATCACGAAGGTCAAACCTCGAGGTTTGACCTTCGTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-570s21c1
Sequence:GTACCGGTGAGCAGCTTCGCCAAGTTAACTCGAGTTAACTTGGCGAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144552.3-932s21c1
Sequence:GTACCGGAGCTTGCCATGAAGCATAAATCTCGAGATTTATGCTTCATGGCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144552.3-1229s21c1
Sequence:GTACCGGAGCATGCTGTGGGCATATATTCTCGAGAATATATGCCCACAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014178
STXBP6 MISSION shRNA Bacterial Glycerol Stock
syntaxin binding protein 6 (amisyn)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014178.6-1592s1c1
Sequence:CCGGCCACTGTGTGTATGTGTGTATCTCGAGATACACACATACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1007s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1129s1c1
Sequence:CCGGGCCAGAGTTTATTAACTGCCACTCGAGTGGCAGTTAATAAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-927s1c1
Sequence:CCGGCCACATCATTTGTTCGGAGATCTCGAGATCTCCGAACAAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1131s1c1
Sequence:CCGGCAGAGTTTATTAACTGCCAATCTCGAGATTGGCAGTTAATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1121s21c1
Sequence:GTACCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-785s21c1
Sequence:GTACCGGCAAGTCAAGAGGAGGACAAAGCTCGAGCTTTGTCCTCCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1528s21c1
Sequence:GTACCGGCCCTAATGATCTTGCTAATAACTCGAGTTATTAGCAAGATCATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-917s21c1
Sequence:GTACCGGTTTGAAGGCTCCACATCATTTCTCGAGAAATGATGTGGAGCCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1000s21c1
Sequence:GTACCGGGGATTCGGCAGAGTTTGATTTCTCGAGAAATCAAACTCTGCCGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1797s21c1
Sequence:GTACCGGAGTCAAGCAGTGATTAGTTTCCTCGAGGAAACTAATCACTGCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1236s21c1
Sequence:GTACCGGATGAGCGTGGAGAGCGATTAGCTCGAGCTAATCGCTCTCCACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1687s21c1
Sequence:GTACCGGTAAACTGCGCTGAGTCTAAACCTCGAGGTTTAGACTCAGCGCAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014178
STXBP6 MISSION shRNA shRNA Plasmid DNA
syntaxin binding protein 6 (amisyn)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014178.6-1592s1c1
Sequence:CCGGCCACTGTGTGTATGTGTGTATCTCGAGATACACACATACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1007s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1129s1c1
Sequence:CCGGGCCAGAGTTTATTAACTGCCACTCGAGTGGCAGTTAATAAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-927s1c1
Sequence:CCGGCCACATCATTTGTTCGGAGATCTCGAGATCTCCGAACAAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1131s1c1
Sequence:CCGGCAGAGTTTATTAACTGCCAATCTCGAGATTGGCAGTTAATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1121s21c1
Sequence:GTACCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-785s21c1
Sequence:GTACCGGCAAGTCAAGAGGAGGACAAAGCTCGAGCTTTGTCCTCCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1528s21c1
Sequence:GTACCGGCCCTAATGATCTTGCTAATAACTCGAGTTATTAGCAAGATCATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-917s21c1
Sequence:GTACCGGTTTGAAGGCTCCACATCATTTCTCGAGAAATGATGTGGAGCCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1000s21c1
Sequence:GTACCGGGGATTCGGCAGAGTTTGATTTCTCGAGAAATCAAACTCTGCCGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1797s21c1
Sequence:GTACCGGAGTCAAGCAGTGATTAGTTTCCTCGAGGAAACTAATCACTGCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1236s21c1
Sequence:GTACCGGATGAGCGTGGAGAGCGATTAGCTCGAGCTAATCGCTCTCCACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1687s21c1
Sequence:GTACCGGTAAACTGCGCTGAGTCTAAACCTCGAGGTTTAGACTCAGCGCAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014178
STXBP6 MISSION shRNA Lentiviral Transduction Particles
syntaxin binding protein 6 (amisyn)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014178.6-1592s1c1
Sequence:CCGGCCACTGTGTGTATGTGTGTATCTCGAGATACACACATACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1007s1c1
Sequence:CCGGGCAGAGTTTGATTTGTTGTTTCTCGAGAAACAACAAATCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1129s1c1
Sequence:CCGGGCCAGAGTTTATTAACTGCCACTCGAGTGGCAGTTAATAAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-927s1c1
Sequence:CCGGCCACATCATTTGTTCGGAGATCTCGAGATCTCCGAACAAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014178.6-1131s1c1
Sequence:CCGGCAGAGTTTATTAACTGCCAATCTCGAGATTGGCAGTTAATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1121s21c1
Sequence:GTACCGGGACAGGAAGCCAGAGTTTATTCTCGAGAATAAACTCTGGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-785s21c1
Sequence:GTACCGGCAAGTCAAGAGGAGGACAAAGCTCGAGCTTTGTCCTCCTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1528s21c1
Sequence:GTACCGGCCCTAATGATCTTGCTAATAACTCGAGTTATTAGCAAGATCATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-917s21c1
Sequence:GTACCGGTTTGAAGGCTCCACATCATTTCTCGAGAAATGATGTGGAGCCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1000s21c1
Sequence:GTACCGGGGATTCGGCAGAGTTTGATTTCTCGAGAAATCAAACTCTGCCGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1797s21c1
Sequence:GTACCGGAGTCAAGCAGTGATTAGTTTCCTCGAGGAAACTAATCACTGCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014178.6-1236s21c1
Sequence:GTACCGGATGAGCGTGGAGAGCGATTAGCTCGAGCTAATCGCTCTCCACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014178.6-1687s21c1
Sequence:GTACCGGTAAACTGCGCTGAGTCTAAACCTCGAGGTTTAGACTCAGCGCAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks