EMAIL THIS PAGE TO A FRIEND

STYK1

serine/threonine/tyrosine kinase 1

Synonyms: NOK SuRTK106
UniProtKB ID: Q6J9G0, B2R9T2, Q52LR3, Q9BXY2, Q9NSH1
Gene ID:
Human(55359) Summary: Receptor protein tyrosine kinases, like STYK1, play important roles in diverse cellular and developmental processes, such as cell proliferation, differentiation, and survival (Liu et al., 2004 [PubMed 15150103]
Mouse(243659) serine/threonine/tyrosine kinase 1
Rat(500340) serine/threonine/tyrosine kinase 1
Zebrafish(324714) serine/threonine/tyrosine kinase 1
domestic cat(101088762) serine/threonine/tyrosine kinase 1
Horse(100063237) serine/threonine/tyrosine kinase 1
dog(486689) serine/threonine/tyrosine kinase 1
chicken(418310) serine/threonine/tyrosine kinase 1
cow(513920) serine/threonine/tyrosine kinase 1
sheep(101115612) serine/threonine/tyrosine kinase 1
domestic guinea pig(100713287) serine/threonine/tyrosine kinase 1
naked mole-rat(101711283) serine/threonine/tyrosine kinase 1
Domestic Rabbit(100344443) serine/threonine/tyrosine kinase 1
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302051 ANTI-MOUSE STYK1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
S5948 Anti-STYK1 (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407663 Anti-STYK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412629 ANTI-STYK1 antibody produced in mouse clone 4A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412630 ANTI-STYK1 antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV47449 Anti-STYK1 antibody produced in rabbit affinity isolated antibody rabbit, mouse, guinea pig, human, rat, horse, canine
western blot pricing
HPA048569 Anti-STYK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411055 Anti-STYK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
HPA040468 Anti-STYK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0055359M1 Monoclonal Anti-STYK1 antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405150 Monoclonal Anti-STYK1 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB5300362 Monoclonal Anti-STYK1 antibody produced in mouse clone 2H2F10, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018423 Rosetta Predictions human pricing
XM_001069819 Rosetta Predictions rat pricing
XM_575692 Rosetta Predictions rat pricing
NM_172891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351937 predicted 1603
2 SASI_Hs01_00043410 predicted 1542
3 SASI_Hs01_00043411 predicted 1328
4 SASI_Hs01_00043412 predicted 1314
5 SASI_Hs01_00043414 predicted 677
6 SASI_Hs01_00043415 predicted 690
7 SASI_Hs01_00043416 predicted 1270
8 SASI_Hs01_00043417 predicted 332
9 SASI_Hs01_00043418 predicted 349
10 SASI_Hs01_00043419 predicted 305
11 SASI_Hs01_00043413 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329414 predicted 474
2 SASI_Rn02_00329415 predicted 1172
3 SASI_Rn02_00329416 predicted 1172
4 SASI_Rn02_00329417 predicted 1014
5 SASI_Rn02_00329418 predicted 391
6 SASI_Rn02_00329419 predicted 1004
7 SASI_Rn02_00329420 predicted 1163
8 SASI_Rn02_00329421 predicted 256
9 SASI_Rn02_00329422 predicted 848
10 SASI_Rn02_00329423 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404120 predicted 941
2 SASI_Rn02_00404121 predicted 406
3 SASI_Rn02_00404122 predicted 559
4 SASI_Rn02_00404123 predicted 556
5 SASI_Rn02_00404124 predicted 973
6 SASI_Rn02_00404125 predicted 798
7 SASI_Rn02_00404126 predicted 551
8 SASI_Rn02_00404127 predicted 800
9 SASI_Rn02_00404128 predicted 959
10 SASI_Rn02_00404129 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344861 predicted 1298
2 SASI_Mm02_00344862 predicted 2138
3 SASI_Mm02_00344863 predicted 2097
4 SASI_Mm02_00344864 predicted 2122
5 SASI_Mm02_00344865 predicted 1206
6 SASI_Mm02_00344866 predicted 2166
7 SASI_Mm02_00344867 predicted 2095
8 SASI_Mm02_00344868 predicted 2159
9 SASI_Mm02_00344869 predicted 1497
10 SASI_Mm02_00344870 predicted 1543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172891
STYK1 MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-1859s21c1
Sequence:CCGGTCCCACCAGCATCCTACAATACTCGAGTATTGTAGGATGCTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2142s21c1
Sequence:CCGGTCCTAGACAAATGACTATATACTCGAGTATATAGTCATTTGTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2634s21c1
Sequence:CCGGAGGTGTTAAGGTGAGTCAATACTCGAGTATTGACTCACCTTAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-922s21c1
Sequence:CCGGAGCAGTATGAAGTAATCATTGCTCGAGCAATGATTACTTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2002s1c1
Sequence:CCGGGCCTAGAAGCTGCTTCTAGATCTCGAGATCTAGAAGCAGCTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1621s1c1
Sequence:CCGGCCAGGAACATCCTGATCCAAACTCGAGTTTGGATCAGGATGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-915s1c1
Sequence:CCGGCGAGAGAAGCAGTATGAAGTACTCGAGTACTTCATACTGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1516s1c1
Sequence:CCGGTGCTCTATGATCTCACAGAAACTCGAGTTTCTGTGAGATCATAGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2064s1c1
Sequence:CCGGGTGCCTGAACTGTATGCAGATCTCGAGATCTGCATACAGTTCAGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172891
STYK1 MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-1859s21c1
Sequence:CCGGTCCCACCAGCATCCTACAATACTCGAGTATTGTAGGATGCTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2142s21c1
Sequence:CCGGTCCTAGACAAATGACTATATACTCGAGTATATAGTCATTTGTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2634s21c1
Sequence:CCGGAGGTGTTAAGGTGAGTCAATACTCGAGTATTGACTCACCTTAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-922s21c1
Sequence:CCGGAGCAGTATGAAGTAATCATTGCTCGAGCAATGATTACTTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2002s1c1
Sequence:CCGGGCCTAGAAGCTGCTTCTAGATCTCGAGATCTAGAAGCAGCTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1621s1c1
Sequence:CCGGCCAGGAACATCCTGATCCAAACTCGAGTTTGGATCAGGATGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-915s1c1
Sequence:CCGGCGAGAGAAGCAGTATGAAGTACTCGAGTACTTCATACTGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1516s1c1
Sequence:CCGGTGCTCTATGATCTCACAGAAACTCGAGTTTCTGTGAGATCATAGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2064s1c1
Sequence:CCGGGTGCCTGAACTGTATGCAGATCTCGAGATCTGCATACAGTTCAGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172891
STYK1 MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-1859s21c1
Sequence:CCGGTCCCACCAGCATCCTACAATACTCGAGTATTGTAGGATGCTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2142s21c1
Sequence:CCGGTCCTAGACAAATGACTATATACTCGAGTATATAGTCATTTGTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172891.2-2634s21c1
Sequence:CCGGAGGTGTTAAGGTGAGTCAATACTCGAGTATTGACTCACCTTAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172891.2-922s21c1
Sequence:CCGGAGCAGTATGAAGTAATCATTGCTCGAGCAATGATTACTTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2002s1c1
Sequence:CCGGGCCTAGAAGCTGCTTCTAGATCTCGAGATCTAGAAGCAGCTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1621s1c1
Sequence:CCGGCCAGGAACATCCTGATCCAAACTCGAGTTTGGATCAGGATGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-915s1c1
Sequence:CCGGCGAGAGAAGCAGTATGAAGTACTCGAGTACTTCATACTGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-1516s1c1
Sequence:CCGGTGCTCTATGATCTCACAGAAACTCGAGTTTCTGTGAGATCATAGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172891.1-2064s1c1
Sequence:CCGGGTGCCTGAACTGTATGCAGATCTCGAGATCTGCATACAGTTCAGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018423
VALIDATED
STYK1 MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine kinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-1109s21c1
Sequence:CCGGGGCCATCTCCTCTACTCAAACCTCGAGGTTTGAGTAGAGGAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-948s21c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-647s21c1
Sequence:CCGGGCCCATCTTTCGAGCCAATATCTCGAGATATTGGCTCGAAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-357s21c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018423.1-1556s21c1
Sequence:CCGGACATTCATGCATGAGTATATGCTCGAGCATATACTCATGCATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018423.x-900s1c1
Sequence:CCGGCGGGATGTGATGACTATGGATCTCGAGATCCATAGTCATCACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-332s1c1
Sequence:CCGGGAAGCAGTATGAAGTGATTATCTCGAGATAATCACTTCATACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018423.1-758s1c1
Sequence:CCGGGCGAATCCAATTCCATCAATACTCGAGTATTGATGGAATTGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-948s1c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-357s1c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018423
VALIDATED
STYK1 MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine kinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-1109s21c1
Sequence:CCGGGGCCATCTCCTCTACTCAAACCTCGAGGTTTGAGTAGAGGAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-948s21c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-647s21c1
Sequence:CCGGGCCCATCTTTCGAGCCAATATCTCGAGATATTGGCTCGAAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-357s21c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018423.1-1556s21c1
Sequence:CCGGACATTCATGCATGAGTATATGCTCGAGCATATACTCATGCATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018423.x-900s1c1
Sequence:CCGGCGGGATGTGATGACTATGGATCTCGAGATCCATAGTCATCACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-332s1c1
Sequence:CCGGGAAGCAGTATGAAGTGATTATCTCGAGATAATCACTTCATACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018423.1-758s1c1
Sequence:CCGGGCGAATCCAATTCCATCAATACTCGAGTATTGATGGAATTGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-948s1c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-357s1c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018423
VALIDATED
STYK1 MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine kinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-1109s21c1
Sequence:CCGGGGCCATCTCCTCTACTCAAACCTCGAGGTTTGAGTAGAGGAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-948s21c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018423.1-647s21c1
Sequence:CCGGGCCCATCTTTCGAGCCAATATCTCGAGATATTGGCTCGAAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018423.1-357s21c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018423.1-1556s21c1
Sequence:CCGGACATTCATGCATGAGTATATGCTCGAGCATATACTCATGCATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018423.x-900s1c1
Sequence:CCGGCGGGATGTGATGACTATGGATCTCGAGATCCATAGTCATCACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-332s1c1
Sequence:CCGGGAAGCAGTATGAAGTGATTATCTCGAGATAATCACTTCATACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018423.1-758s1c1
Sequence:CCGGGCGAATCCAATTCCATCAATACTCGAGTATTGATGGAATTGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-948s1c1
Sequence:CCGGCAAGTATATCACATCGGAAAGCTCGAGCTTTCCGATGTGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_018423.1-357s1c1
Sequence:CCGGCCAACTTTGTTGGTTACTATCCTCGAGGATAGTAACCAACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks