EMAIL THIS PAGE TO A FRIEND

STYX

serine/threonine/tyrosine interacting protein

UniProtKB ID: Q8WUJ0, B9EJG0, Q99850
Gene ID:
Human(6815) Summary: The protein encoded by this gene is a pseudophosphatase, able to bind potential substrates but lacking an active catalytic loop. The encoded protein may be involved in spermiogenesis. Two transcript variants encoding the same protein have been found for these genes. [provided by RefSeq, Oct 2011]
Mouse(56291) serine/threonine/tyrosine interaction protein
Rat(100912536) serine/threonine/tyrosine interacting protein
naked mole-rat(101714903) serine/threonine/tyrosine interacting protein
domestic guinea pig(100731024) serine/threonine/tyrosine interacting protein
cow(616825) serine/threonine/tyrosine interacting protein
sheep(101115709) serine/threonine/tyrosine interacting protein
Zebrafish(554088) serine/threonine/tyrosine interacting protein
domestic cat(101099053) serine/threonine/tyrosine interacting protein
dog(490692) serine/threonine/tyrosine interacting protein
chicken(423587) serine/threonine/tyrosine interacting protein
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145251 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145251 siRNAs that have been validated in the lab human pricing
NM_019637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145251 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035636 validated 525
1 SASI_Hs01_00035638 validated 1416
1 SASI_Hs01_00035637 validated 764
2 SASI_Hs01_00035640 predicted 423
3 SASI_Hs01_00035642 predicted 636
4 SASI_Hs02_00365097 predicted 635
5 SASI_Hs02_00365098 predicted 419
6 SASI_Hs02_00365099 predicted 554
7 SASI_Hs02_00365100 predicted 631
8 SASI_Hs02_00365101 predicted 397
9 SASI_Hs01_00035645 predicted 1300
10 SASI_Hs01_00035639 predicted 1252
11 SASI_Hs01_00035641 predicted 1416
12 SASI_Hs01_00035643 predicted 565
13 SASI_Hs01_00035644 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130034 predicted 831
2 SASI_Mm01_00130036 predicted 399
3 SASI_Mm01_00130037 predicted 541
4 SASI_Mm01_00130038 predicted 542
5 SASI_Mm01_00130039 predicted 498
6 SASI_Mm01_00130040 predicted 884
7 SASI_Mm01_00130041 predicted 707
8 SASI_Mm01_00130042 predicted 656
9 SASI_Mm01_00130035 predicted 672
10 SASI_Mm01_00130043 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019637
STYX MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019637.2-2520s1c1
Sequence:CCGGGCCTGAATATAAACCAGAATTCTCGAGAATTCTGGTTTATATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-852s1c1
Sequence:CCGGGAAAGGTCCTTAGCTGTTCATCTCGAGATGAACAGCTAAGGACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-584s1c1
Sequence:CCGGCCCTATGACTAAAGAGTTTATCTCGAGATAAACTCTTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-462s1c1
Sequence:CCGGCATATAATTTGCATACGGCAACTCGAGTTGCCGTATGCAAATTATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-903s1c1
Sequence:CCGGCATGAGGAAGATGACGACTTTCTCGAGAAAGTCGTCATCTTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019637.3-1019s21c1
Sequence:CCGGTGATAATGTGAAATGGTAAACCTCGAGGTTTACCATTTCACATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-830s21c1
Sequence:CCGGGATGATGTCACCACTCCAAATCTCGAGATTTGGAGTGGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-439s21c1
Sequence:CCGGTACTTCAGAAACATGGCATAACTCGAGTTATGCCATGTTTCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019637
STYX MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019637.2-2520s1c1
Sequence:CCGGGCCTGAATATAAACCAGAATTCTCGAGAATTCTGGTTTATATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-852s1c1
Sequence:CCGGGAAAGGTCCTTAGCTGTTCATCTCGAGATGAACAGCTAAGGACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-584s1c1
Sequence:CCGGCCCTATGACTAAAGAGTTTATCTCGAGATAAACTCTTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-462s1c1
Sequence:CCGGCATATAATTTGCATACGGCAACTCGAGTTGCCGTATGCAAATTATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-903s1c1
Sequence:CCGGCATGAGGAAGATGACGACTTTCTCGAGAAAGTCGTCATCTTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019637.3-1019s21c1
Sequence:CCGGTGATAATGTGAAATGGTAAACCTCGAGGTTTACCATTTCACATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-830s21c1
Sequence:CCGGGATGATGTCACCACTCCAAATCTCGAGATTTGGAGTGGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-439s21c1
Sequence:CCGGTACTTCAGAAACATGGCATAACTCGAGTTATGCCATGTTTCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019637
STYX MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019637.2-2520s1c1
Sequence:CCGGGCCTGAATATAAACCAGAATTCTCGAGAATTCTGGTTTATATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-852s1c1
Sequence:CCGGGAAAGGTCCTTAGCTGTTCATCTCGAGATGAACAGCTAAGGACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-584s1c1
Sequence:CCGGCCCTATGACTAAAGAGTTTATCTCGAGATAAACTCTTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-462s1c1
Sequence:CCGGCATATAATTTGCATACGGCAACTCGAGTTGCCGTATGCAAATTATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019637.2-903s1c1
Sequence:CCGGCATGAGGAAGATGACGACTTTCTCGAGAAAGTCGTCATCTTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019637.3-1019s21c1
Sequence:CCGGTGATAATGTGAAATGGTAAACCTCGAGGTTTACCATTTCACATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-830s21c1
Sequence:CCGGGATGATGTCACCACTCCAAATCTCGAGATTTGGAGTGGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019637.3-439s21c1
Sequence:CCGGTACTTCAGAAACATGGCATAACTCGAGTTATGCCATGTTTCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145251
STYX MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine interacting protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145251.2-942s1c1
Sequence:CCGGGCAACATCATAGAGTGTGAATCTCGAGATTCACACTCTATGATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-817s1c1
Sequence:CCGGCTCCAGATAGAAAGGTCATTACTCGAGTAATGACCTTTCTATCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-742s1c1
Sequence:CCGGGCTGGATTTGTCCATCAACTTCTCGAGAAGTTGATGGACAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-378s1c1
Sequence:CCGGCCCATATTCATCTGCTATGAACTCGAGTTCATAGCAGATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-558s1c1
Sequence:CCGGCCCTATGACTAAGGAATTTATCTCGAGATAAATTCCTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-867s21c1
Sequence:CCGGTCCAGATAGAAAGGTCATTATCTCGAGATAATGACCTTTCTATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-472s21c1
Sequence:CCGGACATGGAATAACCCATATAATCTCGAGATTATATGGGTTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-414s21c1
Sequence:CCGGGATTGTTCTTAGGCCCATATTCTCGAGAATATGGGCCTAAGAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145251
STYX MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine interacting protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145251.2-942s1c1
Sequence:CCGGGCAACATCATAGAGTGTGAATCTCGAGATTCACACTCTATGATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-817s1c1
Sequence:CCGGCTCCAGATAGAAAGGTCATTACTCGAGTAATGACCTTTCTATCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-742s1c1
Sequence:CCGGGCTGGATTTGTCCATCAACTTCTCGAGAAGTTGATGGACAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-378s1c1
Sequence:CCGGCCCATATTCATCTGCTATGAACTCGAGTTCATAGCAGATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-558s1c1
Sequence:CCGGCCCTATGACTAAGGAATTTATCTCGAGATAAATTCCTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-867s21c1
Sequence:CCGGTCCAGATAGAAAGGTCATTATCTCGAGATAATGACCTTTCTATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-472s21c1
Sequence:CCGGACATGGAATAACCCATATAATCTCGAGATTATATGGGTTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-414s21c1
Sequence:CCGGGATTGTTCTTAGGCCCATATTCTCGAGAATATGGGCCTAAGAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145251
STYX MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine interacting protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145251.2-942s1c1
Sequence:CCGGGCAACATCATAGAGTGTGAATCTCGAGATTCACACTCTATGATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-817s1c1
Sequence:CCGGCTCCAGATAGAAAGGTCATTACTCGAGTAATGACCTTTCTATCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-742s1c1
Sequence:CCGGGCTGGATTTGTCCATCAACTTCTCGAGAAGTTGATGGACAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-378s1c1
Sequence:CCGGCCCATATTCATCTGCTATGAACTCGAGTTCATAGCAGATGAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145251.2-558s1c1
Sequence:CCGGCCCTATGACTAAGGAATTTATCTCGAGATAAATTCCTTAGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-867s21c1
Sequence:CCGGTCCAGATAGAAAGGTCATTATCTCGAGATAATGACCTTTCTATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-472s21c1
Sequence:CCGGACATGGAATAACCCATATAATCTCGAGATTATATGGGTTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145251.3-414s21c1
Sequence:CCGGGATTGTTCTTAGGCCCATATTCTCGAGAATATGGGCCTAAGAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks