EMAIL THIS PAGE TO A FRIEND

STYXL1

serine/threonine/tyrosine interacting-like 1

Synonyms: DUSP24 MK-STYX
UniProtKB ID: Q9Y6J8, Q9UBP1, Q9UK06, Q9UK07, Q9UKG2, Q9UKG3
Gene ID:
Mouse(76571) serine/threonine/tyrosine interacting-like 1
Rat(360792) serine/threonine/tyrosine interacting-like 1
Zebrafish(447880) serine/threonine/tyrosine interacting-like 1
chicken(417518) serine/threonine/tyrosine interacting-like 1
domestic cat(101085090) serine/threonine/tyrosine interacting-like 1
dog(489817) serine/threonine/tyrosine interacting-like 1
cow(513107) serine/threonine/tyrosine interacting-like 1
sheep(101118326) serine/threonine/tyrosine interacting-like 1
domestic guinea pig(100723091) serine/threonine/tyrosine interacting-like 1
naked mole-rat(101714109) serine/threonine/tyrosine interacting-like 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016086 Rosetta Predictions human pricing
NM_001037788 Rosetta Predictions rat pricing
NM_029659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106073 predicted 1095
2 SASI_Hs01_00106075 predicted 788
3 SASI_Hs02_00348838 predicted 833
4 SASI_Hs01_00106077 predicted 1163
5 SASI_Hs01_00106078 predicted 527
6 SASI_Hs01_00106079 predicted 425
7 SASI_Hs02_00348839 predicted 459
8 SASI_Hs01_00106080 predicted 1004
9 SASI_Hs01_00106081 predicted 435
10 SASI_Hs02_00348840 predicted 900
11 SASI_Hs01_00106072 predicted 625
12 SASI_Hs01_00106074 predicted 850
13 SASI_Hs01_00106076 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031626 predicted 871
2 SASI_Rn01_00031627 predicted 763
3 SASI_Rn01_00031628 predicted 673
4 SASI_Rn01_00031630 predicted 613
5 SASI_Rn01_00031631 predicted 686
6 SASI_Rn01_00031632 predicted 560
7 SASI_Rn01_00031633 predicted 666
8 SASI_Rn01_00031634 predicted 563
9 SASI_Rn01_00031635 predicted 565
10 SASI_Rn02_00204597 predicted 758
11 SASI_Rn01_00031629 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033610 predicted 610
2 SASI_Mm01_00033611 predicted 440
3 SASI_Mm01_00033612 predicted 366
4 SASI_Mm01_00033614 predicted 677
5 SASI_Mm01_00033615 predicted 525
6 SASI_Mm02_00335684 predicted 420
7 SASI_Mm01_00033616 predicted 422
8 SASI_Mm01_00033617 predicted 718
9 SASI_Mm01_00033618 predicted 505
10 SASI_Mm01_00033619 predicted 517
11 SASI_Mm01_00033613 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029659
STYXL1 MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine interacting-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-618s21c1
Sequence:CCGGCACTCTGTCGTTCTGGTCTTTCTCGAGAAAGACCAGAACGACAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-422s21c1
Sequence:CCGGCAGTCAAGCCTGCAATGCTAACTCGAGTTAGCATTGCAGGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-786s21c1
Sequence:CCGGGAGTGGGAGAAAGTCCTCCATCTCGAGATGGAGGACTTTCTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-485s1c1
Sequence:CCGGCCATGGAGACAACACCCTATTCTCGAGAATAGGGTGTTGTCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-679s1c1
Sequence:CCGGGCCTTACTCATGCATTATAATCTCGAGATTATAATGCATGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-525s1c1
Sequence:CCGGGCTCTTACATATCAAGCTTGACTCGAGTCAAGCTTGATATGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-578s1c1
Sequence:CCGGTCCGCCACATCTGTCACTTTACTCGAGTAAAGTGACAGATGTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-376s1c1
Sequence:CCGGCCATACCCAGTTGAGATACTTCTCGAGAAGTATCTCAACTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029659
STYXL1 MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine interacting-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-618s21c1
Sequence:CCGGCACTCTGTCGTTCTGGTCTTTCTCGAGAAAGACCAGAACGACAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-422s21c1
Sequence:CCGGCAGTCAAGCCTGCAATGCTAACTCGAGTTAGCATTGCAGGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-786s21c1
Sequence:CCGGGAGTGGGAGAAAGTCCTCCATCTCGAGATGGAGGACTTTCTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-485s1c1
Sequence:CCGGCCATGGAGACAACACCCTATTCTCGAGAATAGGGTGTTGTCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-679s1c1
Sequence:CCGGGCCTTACTCATGCATTATAATCTCGAGATTATAATGCATGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-525s1c1
Sequence:CCGGGCTCTTACATATCAAGCTTGACTCGAGTCAAGCTTGATATGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-578s1c1
Sequence:CCGGTCCGCCACATCTGTCACTTTACTCGAGTAAAGTGACAGATGTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-376s1c1
Sequence:CCGGCCATACCCAGTTGAGATACTTCTCGAGAAGTATCTCAACTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029659
STYXL1 MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine interacting-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-618s21c1
Sequence:CCGGCACTCTGTCGTTCTGGTCTTTCTCGAGAAAGACCAGAACGACAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-422s21c1
Sequence:CCGGCAGTCAAGCCTGCAATGCTAACTCGAGTTAGCATTGCAGGCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029659.3-786s21c1
Sequence:CCGGGAGTGGGAGAAAGTCCTCCATCTCGAGATGGAGGACTTTCTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-485s1c1
Sequence:CCGGCCATGGAGACAACACCCTATTCTCGAGAATAGGGTGTTGTCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-679s1c1
Sequence:CCGGGCCTTACTCATGCATTATAATCTCGAGATTATAATGCATGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-525s1c1
Sequence:CCGGGCTCTTACATATCAAGCTTGACTCGAGTCAAGCTTGATATGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-578s1c1
Sequence:CCGGTCCGCCACATCTGTCACTTTACTCGAGTAAAGTGACAGATGTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029659.2-376s1c1
Sequence:CCGGCCATACCCAGTTGAGATACTTCTCGAGAAGTATCTCAACTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016086
VALIDATED
STYXL1 MISSION shRNA Bacterial Glycerol Stock
serine/threonine/tyrosine interacting-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1118s21c1
Sequence:GTACCGGGCCTACCTCATGCATAGTAACCTCGAGGTTACTATGCATGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-555s21c1
Sequence:GTACCGGTGAAGTACTGCGTGGTGTATGCTCGAGCATACACCACGCAGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1006s21c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-376s21c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1222s21c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1346s21c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-450s21c1
Sequence:GTACCGGTCCGTTCCAAATGGGAGTATGCTCGAGCATACTCCCATTTGGAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1346s1c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016086.x-1129s1c1
Sequence:CCGGGCATAGTAACGAGCAGACCTTCTCGAGAAGGTCTGCTCGTTACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1222s1c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-376s1c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1006s1c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016086
VALIDATED
STYXL1 MISSION shRNA shRNA Plasmid DNA
serine/threonine/tyrosine interacting-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1118s21c1
Sequence:GTACCGGGCCTACCTCATGCATAGTAACCTCGAGGTTACTATGCATGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-555s21c1
Sequence:GTACCGGTGAAGTACTGCGTGGTGTATGCTCGAGCATACACCACGCAGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1006s21c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-376s21c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1222s21c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1346s21c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-450s21c1
Sequence:GTACCGGTCCGTTCCAAATGGGAGTATGCTCGAGCATACTCCCATTTGGAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1346s1c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016086.x-1129s1c1
Sequence:CCGGGCATAGTAACGAGCAGACCTTCTCGAGAAGGTCTGCTCGTTACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1222s1c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-376s1c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1006s1c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016086
VALIDATED
STYXL1 MISSION shRNA Lentiviral Transduction Particles
serine/threonine/tyrosine interacting-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1118s21c1
Sequence:GTACCGGGCCTACCTCATGCATAGTAACCTCGAGGTTACTATGCATGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-555s21c1
Sequence:GTACCGGTGAAGTACTGCGTGGTGTATGCTCGAGCATACACCACGCAGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-1006s21c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-376s21c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1222s21c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016086.2-1346s21c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016086.2-450s21c1
Sequence:GTACCGGTCCGTTCCAAATGGGAGTATGCTCGAGCATACTCCCATTTGGAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1346s1c1
Sequence:CCGGGAGGGCCAGAGTGTGTATACCCTCGAGGGTATACACACTCTGGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016086.x-1129s1c1
Sequence:CCGGGCATAGTAACGAGCAGACCTTCTCGAGAAGGTCTGCTCGTTACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1222s1c1
Sequence:CCGGGCTGGAATGGGAGAAGACTATCTCGAGATAGTCTTCTCCCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-376s1c1
Sequence:CCGGGCTTTACAACATCCTGAATCACTCGAGTGATTCAGGATGTTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016086.x-1006s1c1
Sequence:CCGGTCTTCCCTTCTTACGCCACATCTCGAGATGTGGCGTAAGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks