EMAIL THIS PAGE TO A FRIEND

SUB1

SUB1 homolog (S. cerevisiae)

Synonyms: P15 PC4 p14
UniProtKB ID: P53999, Q96L29
Gene ID:
Mouse(20024) SUB1 homolog (S. cerevisiae)
Rat(192269) SUB1 homolog (S. cerevisiae)
Thale Cress(826452) calcium ion binding protein
domestic cat(101099862) SUB1 homolog (S. cerevisiae)
chicken(427425) SUB1 homolog (S. cerevisiae)
domestic guinea pig(100716824) SUB1 homolog (S. cerevisiae)
naked mole-rat(101722999) SUB1 homolog (S. cerevisiae)
cow(533984) SUB1 homolog (S. cerevisiae)
sheep(101114812) SUB1 homolog (S. cerevisiae)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV100959 Anti-PC4 (AB1) antibody produced in rabbit IgG fraction of antiserum human, canine, bovine, mouse, rat
immunohistochemistry, western blot pricing
AV100960 Anti-PC4 (AB2) antibody produced in rabbit IgG fraction of antiserum zebrafish, human, yeast, rat, canine, bovine, mouse
immunohistochemistry, western blot pricing
HPA001311 Anti-SUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1403093 Monoclonal Anti-SUB1 antibody produced in mouse clone 3A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006713 Rosetta Predictions human pricing
NM_001009618 Rosetta Predictions rat pricing
NM_011294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049613 predicted 220
2 SASI_Hs01_00049605 predicted 264
3 SASI_Hs02_00342138 predicted 258
4 SASI_Hs02_00342139 predicted 224
5 SASI_Hs01_00049606 predicted 233
6 SASI_Hs01_00049608 predicted 325
7 SASI_Hs02_00342140 predicted 294
8 SASI_Hs01_00049604 predicted 796
9 SASI_Hs01_00049610 predicted 822
10 SASI_Hs01_00049611 predicted 292
11 SASI_Hs01_00049607 predicted 789
12 SASI_Hs01_00049609 predicted 798
13 SASI_Hs01_00049612 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080139 predicted 262
2 SASI_Rn01_00080140 predicted 291
3 SASI_Rn01_00080141 predicted 288
4 SASI_Rn01_00080142 predicted 291
5 SASI_Rn01_00080143 predicted 320
6 SASI_Rn01_00080144 predicted 361
7 SASI_Rn01_00080145 predicted 268
8 SASI_Rn01_00080146 predicted 245
9 SASI_Rn02_00199619 predicted 388
10 SASI_Rn02_00199620 predicted 330
11 SASI_Rn01_00080147 predicted 477
12 SASI_Rn01_00080148 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320357 predicted 787
2 SASI_Mm02_00320358 predicted 264
3 SASI_Mm01_00132499 predicted 863
4 SASI_Mm01_00132501 predicted 874
5 SASI_Mm01_00132502 predicted 873
6 SASI_Mm01_00132503 predicted 270
7 SASI_Mm01_00132505 predicted 927
8 SASI_Mm01_00132506 predicted 797
9 SASI_Mm02_00320359 predicted 927
10 SASI_Mm02_00320360 predicted 264
11 SASI_Mm01_00132500 predicted 326
12 SASI_Mm01_00132504 predicted 233
13 SASI_Mm01_00132507 predicted 783
14 SASI_Mm01_00132508 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011294
VALIDATED
SUB1 MISSION shRNA Bacterial Glycerol Stock
SUB1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-411s1c1
Sequence:CCGGCTGATATAGATGACGCAGTAACTCGAGTTACTGCGTCATCTATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-421s1c1
Sequence:CCGGTGACGCAGTAAGAAAGCTGTACTCGAGTACAGCTTTCTTACTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-272s1c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-87s1c1
Sequence:CCGGCAAGCTCTTCAGGCAGTGATTCTCGAGAATCACTGCCTGAAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-250s1c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-313s21c1
Sequence:CCGGTAGAGAATATTGGATGGATTCCTCGAGGAATCCATCCAATATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011294.3-942s21c1
Sequence:CCGGCTCAGATAGATTACGCTTATTCTCGAGAATAAGCGTAATCTATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-272s21c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-250s21c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-154s21c1
Sequence:CCGGTCCAGAGAAGCCCGTGAAGAACTCGAGTTCTTCACGGGCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011294
VALIDATED
SUB1 MISSION shRNA shRNA Plasmid DNA
SUB1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-411s1c1
Sequence:CCGGCTGATATAGATGACGCAGTAACTCGAGTTACTGCGTCATCTATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-421s1c1
Sequence:CCGGTGACGCAGTAAGAAAGCTGTACTCGAGTACAGCTTTCTTACTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-272s1c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-87s1c1
Sequence:CCGGCAAGCTCTTCAGGCAGTGATTCTCGAGAATCACTGCCTGAAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-250s1c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-313s21c1
Sequence:CCGGTAGAGAATATTGGATGGATTCCTCGAGGAATCCATCCAATATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011294.3-942s21c1
Sequence:CCGGCTCAGATAGATTACGCTTATTCTCGAGAATAAGCGTAATCTATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-272s21c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-250s21c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-154s21c1
Sequence:CCGGTCCAGAGAAGCCCGTGAAGAACTCGAGTTCTTCACGGGCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011294
VALIDATED
SUB1 MISSION shRNA Lentiviral Transduction Particles
SUB1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-411s1c1
Sequence:CCGGCTGATATAGATGACGCAGTAACTCGAGTTACTGCGTCATCTATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-421s1c1
Sequence:CCGGTGACGCAGTAAGAAAGCTGTACTCGAGTACAGCTTTCTTACTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-272s1c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011294.2-87s1c1
Sequence:CCGGCAAGCTCTTCAGGCAGTGATTCTCGAGAATCACTGCCTGAAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011294.2-250s1c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-313s21c1
Sequence:CCGGTAGAGAATATTGGATGGATTCCTCGAGGAATCCATCCAATATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011294.3-942s21c1
Sequence:CCGGCTCAGATAGATTACGCTTATTCTCGAGAATAAGCGTAATCTATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-272s21c1
Sequence:CCGGGTCAGTGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-250s21c1
Sequence:CCGGCCAGATTGGAAAGATGAGATACTCGAGTATCTCATCTTTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011294.3-154s21c1
Sequence:CCGGTCCAGAGAAGCCCGTGAAGAACTCGAGTTCTTCACGGGCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006713
VALIDATED
SUB1 MISSION shRNA Bacterial Glycerol Stock
SUB1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-399s1c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-266s1c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-395s1c1
Sequence:CCGGGAAGGAACAGATTTCTGACATCTCGAGATGTCAGAAATCTGTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_006713.2-387s1c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-412s1c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-338s21c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-484s21c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-471s21c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-459s21c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006713
VALIDATED
SUB1 MISSION shRNA shRNA Plasmid DNA
SUB1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-399s1c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-266s1c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-395s1c1
Sequence:CCGGGAAGGAACAGATTTCTGACATCTCGAGATGTCAGAAATCTGTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_006713.2-387s1c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-412s1c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-338s21c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-484s21c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-471s21c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-459s21c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006713
VALIDATED
SUB1 MISSION shRNA Lentiviral Transduction Particles
SUB1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-399s1c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-266s1c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-395s1c1
Sequence:CCGGGAAGGAACAGATTTCTGACATCTCGAGATGTCAGAAATCTGTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_006713.2-387s1c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006713.2-412s1c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-338s21c1
Sequence:CCGGGTACGTTAGTGTTCGCGATTTCTCGAGAAATCGCGAACACTAACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-484s21c1
Sequence:CCGGACATTGATGATGCAGTAAGAACTCGAGTTCTTACTGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-471s21c1
Sequence:CCGGGAACAGATTTCTGACATTGATCTCGAGATCAATGTCAGAAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006713.3-459s21c1
Sequence:CCGGAGCCAGCTGAAGGAACAGATTCTCGAGAATCTGTTCCTTCAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks