EMAIL THIS PAGE TO A FRIEND

SUCLA2

succinate-CoA ligase, ADP-forming, beta subunit

Synonyms: A-BETA MTDPS5 SCS-betaA
Gene ID:
Human(8803) Summary: Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(20916) succinate-Coenzyme A ligase, ADP-forming, beta subunit
Rat(361071) succinate-CoA ligase, ADP-forming, beta subunit
Zebrafish(406299) succinate-CoA ligase, ADP-forming, beta subunit
chicken(418857) succinate-CoA ligase, ADP-forming, beta subunit
dog(485448) succinate-CoA ligase, ADP-forming, beta subunit
domestic cat(101096373) succinate-CoA ligase, ADP-forming, beta subunit
cow(511090) succinate-CoA ligase, ADP-forming, beta subunit
sheep(101113602) succinate-CoA ligase, ADP-forming, beta subunit
naked mole-rat(101706452) succinate-CoA ligase, ADP-forming, beta subunit
Domestic Rabbit(100356400) succinate-CoA ligase, ADP-forming, beta subunit
domestic guinea pig(100714608) succinate-CoA ligase, ADP-forming, beta subunit
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003850 Rosetta Predictions human pricing
NM_001108387 Rosetta Predictions rat pricing
NM_011506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018684 predicted 695
2 SASI_Hs01_00018686 predicted 805
3 SASI_Hs01_00018687 predicted 1162
4 SASI_Hs01_00018688 predicted 605
5 SASI_Hs01_00018689 predicted 1221
6 SASI_Hs01_00018690 predicted 450
7 SASI_Hs01_00018691 predicted 1401
8 SASI_Hs01_00018692 predicted 864
9 SASI_Hs01_00018693 predicted 977
10 SASI_Hs02_00336428 predicted 1003
11 SASI_Hs01_00018685 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238159 predicted 1115
2 SASI_Rn02_00238160 predicted 609
3 SASI_Rn02_00238161 predicted 901
4 SASI_Rn02_00238162 predicted 442
5 SASI_Rn02_00238163 predicted 647
6 SASI_Rn02_00238164 predicted 1141
7 SASI_Rn02_00238165 predicted 748
8 SASI_Rn02_00238166 predicted 494
9 SASI_Rn02_00238167 predicted 1168
10 SASI_Rn02_00238168 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110062 predicted 624
2 SASI_Mm01_00110063 predicted 464
3 SASI_Mm01_00110064 predicted 669
4 SASI_Mm01_00110065 predicted 541
5 SASI_Mm01_00110066 predicted 1350
6 SASI_Mm01_00110067 predicted 508
7 SASI_Mm01_00110068 predicted 761
8 SASI_Mm01_00110069 predicted 1430
9 SASI_Mm01_00110070 predicted 1081
10 SASI_Mm01_00110071 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011506
SUCLA2 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, ADP-forming, beta subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-183s21c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011506.3-1437s21c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1087s21c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1046s21c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011506.1-1438s1c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-184s1c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1350s1c1
Sequence:CCGGCTCTCTGAAATAGTGACCTTACTCGAGTAAGGTCACTATTTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1088s1c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1047s1c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011506
SUCLA2 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, ADP-forming, beta subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-183s21c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011506.3-1437s21c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1087s21c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1046s21c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011506.1-1438s1c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-184s1c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1350s1c1
Sequence:CCGGCTCTCTGAAATAGTGACCTTACTCGAGTAAGGTCACTATTTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1088s1c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1047s1c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011506
SUCLA2 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, ADP-forming, beta subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-183s21c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011506.3-1437s21c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1087s21c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011506.3-1046s21c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011506.1-1438s1c1
Sequence:CCGGCGGGTATTAATGTGCTGTAATCTCGAGATTACAGCACATTAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-184s1c1
Sequence:CCGGCGCTGCATGAATACTTGAGTACTCGAGTACTCAAGTATTCATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1350s1c1
Sequence:CCGGCTCTCTGAAATAGTGACCTTACTCGAGTAAGGTCACTATTTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1088s1c1
Sequence:CCGGGCAAGTAACAGAAGCGTTTAACTCGAGTTAAACGCTTCTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011506.1-1047s1c1
Sequence:CCGGCCAGCCAACTTTCTTGATGTTCTCGAGAACATCAAGAAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003850
VALIDATED
SUCLA2 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, ADP-forming, beta subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-807s21c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1119s21c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1383s21c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-544s21c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1081s21c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1081s1c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-544s1c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1119s1c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-807s1c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003850.1-1383s1c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003850
VALIDATED
SUCLA2 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, ADP-forming, beta subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-807s21c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1119s21c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1383s21c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-544s21c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1081s21c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1081s1c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-544s1c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1119s1c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-807s1c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003850.1-1383s1c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003850
VALIDATED
SUCLA2 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, ADP-forming, beta subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-807s21c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1119s21c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1383s21c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-544s21c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003850.2-1081s21c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1081s1c1
Sequence:CCGGCCAGCCAACTTCCTTGATGTTCTCGAGAACATCAAGGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-544s1c1
Sequence:CCGGCCCAGGAGAGAATACTACTTTCTCGAGAAAGTAGTATTCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-1119s1c1
Sequence:CCGGCCATCAAGTAACAGAAGCATTCTCGAGAATGCTTCTGTTACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003850.1-807s1c1
Sequence:CCGGCGATGCAACCATGATAGAAATCTCGAGATTTCTATCATGGTTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003850.1-1383s1c1
Sequence:CCGGGCTCTCTGAAATAGTGACCTTCTCGAGAAGGTCACTATTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks