EMAIL THIS PAGE TO A FRIEND

SUCLG1

succinate-CoA ligase, alpha subunit

Synonyms: GALPHA MTDPS9 SUCLA1
UniProtKB ID: P53597, Q9BWB0, Q9UNP6
Gene ID:
Human(8802) Summary: This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Mouse(56451) succinate-CoA ligase, GDP-forming, alpha subunit
Rat(114597) succinate-CoA ligase, alpha subunit
Zebrafish(436850) succinate-CoA ligase, GDP-forming, alpha subunit
chicken(422932) succinate-CoA ligase, alpha subunit
domestic cat(101084188) succinate-CoA ligase, alpha subunit
dog(475775) succinate-CoA ligase, alpha subunit
domestic guinea pig(100730352) succinate-CoA ligase, alpha subunit
naked mole-rat(101711758) succinate-CoA ligase, alpha subunit
cow(509983) succinate-CoA ligase, alpha subunit
sheep(101122512) succinate-CoA ligase, alpha subunit
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003849 Rosetta Predictions human pricing
NM_053752 Rosetta Predictions rat pricing
NM_019879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182014 predicted 845
2 SASI_Hs02_00336422 predicted 707
3 SASI_Hs01_00182017 predicted 587
4 SASI_Hs02_00336423 predicted 715
5 SASI_Hs01_00182019 predicted 611
6 SASI_Hs02_00336424 predicted 843
7 SASI_Hs02_00336425 predicted 328
8 SASI_Hs02_00336426 predicted 332
9 SASI_Hs01_00182021 predicted 658
10 SASI_Hs02_00336427 predicted 816
11 SASI_Hs01_00182012 predicted 808
12 SASI_Hs01_00182013 predicted 749
13 SASI_Hs01_00182015 predicted 322
14 SASI_Hs01_00182016 predicted 573
15 SASI_Hs01_00182018 predicted 599
16 SASI_Hs01_00182020 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064622 predicted 586
2 SASI_Rn01_00064623 predicted 756
3 SASI_Rn01_00064624 predicted 556
4 SASI_Rn01_00064625 predicted 1008
5 SASI_Rn02_00266536 predicted 1014
6 SASI_Rn01_00064626 predicted 825
7 SASI_Rn01_00064628 predicted 643
8 SASI_Rn01_00064629 predicted 415
9 SASI_Rn01_00064630 predicted 970
10 SASI_Rn01_00064631 predicted 430
11 SASI_Rn01_00064627 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108722 predicted 562
2 SASI_Mm01_00108723 predicted 731
3 SASI_Mm01_00108724 predicted 790
4 SASI_Mm01_00108725 predicted 203
5 SASI_Mm01_00108726 predicted 733
6 SASI_Mm01_00108727 predicted 657
7 SASI_Mm01_00108728 predicted 654
8 SASI_Mm01_00108729 predicted 816
9 SASI_Mm01_00108730 predicted 783
10 SASI_Mm01_00108731 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003849
VALIDATED
SUCLG1 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, alpha subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-1059s1c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-805s1c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-131s1c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003849.1-215s1c1
Sequence:CCGGGCATTGGAATATGGCACCAAACTCGAGTTTGGTGCCATATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-996s1c1
Sequence:CCGGCGATCTACAAGGAATTTGAAACTCGAGTTTCAAATTCCTTGTAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003849.2-1260s21c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-1006s21c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-332s21c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003849.2-530s21c1
Sequence:CCGGGCAACGGCTTCTGTCATTTATCTCGAGATAAATGACAGAAGCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003849
VALIDATED
SUCLG1 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, alpha subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-1059s1c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-805s1c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-131s1c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003849.1-215s1c1
Sequence:CCGGGCATTGGAATATGGCACCAAACTCGAGTTTGGTGCCATATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-996s1c1
Sequence:CCGGCGATCTACAAGGAATTTGAAACTCGAGTTTCAAATTCCTTGTAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003849.2-1260s21c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-1006s21c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-332s21c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003849.2-530s21c1
Sequence:CCGGGCAACGGCTTCTGTCATTTATCTCGAGATAAATGACAGAAGCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003849
VALIDATED
SUCLG1 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, alpha subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-1059s1c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-805s1c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-131s1c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003849.1-215s1c1
Sequence:CCGGGCATTGGAATATGGCACCAAACTCGAGTTTGGTGCCATATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003849.1-996s1c1
Sequence:CCGGCGATCTACAAGGAATTTGAAACTCGAGTTTCAAATTCCTTGTAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003849.2-1260s21c1
Sequence:CCGGTGGAATGGATCACGTAGACATCTCGAGATGTCTACGTGATCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-1006s21c1
Sequence:CCGGGCAACATAATTCAGGTCCAAACTCGAGTTTGGACCTGAATTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003849.2-332s21c1
Sequence:CCGGCGGCAACATCTCTATGTTGATCTCGAGATCAACATAGAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003849.2-530s21c1
Sequence:CCGGGCAACGGCTTCTGTCATTTATCTCGAGATAAATGACAGAAGCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019879
VALIDATED
SUCLG1 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, alpha subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019879.1-1027s1c1
Sequence:CCGGAGGACACAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-279s1c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-786s1c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-405s1c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-119s1c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-572s21c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-286s21c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-953s21c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-446s21c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019879
VALIDATED
SUCLG1 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, alpha subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019879.1-1027s1c1
Sequence:CCGGAGGACACAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-279s1c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-786s1c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-405s1c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-119s1c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-572s21c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-286s21c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-953s21c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-446s21c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019879
VALIDATED
SUCLG1 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, alpha subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019879.1-1027s1c1
Sequence:CCGGAGGACACAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-279s1c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-786s1c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-405s1c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019879.1-119s1c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-572s21c1
Sequence:CCGGTGTGTGCATTACGGAAGGTATCTCGAGATACCTTCCGTAATGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-286s21c1
Sequence:CCGGCCTCTCGGAAACATATCTATACTCGAGTATAGATATGTTTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-953s21c1
Sequence:CCGGCGCGTTTCTGAAGGAGCATAACTCGAGTTATGCTCCTTCAGAAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019879.3-446s21c1
Sequence:CCGGGCCCGTCTTTAATACTGTGAACTCGAGTTCACAGTATTAAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks