EMAIL THIS PAGE TO A FRIEND

SUCLG2

succinate-CoA ligase, GDP-forming, beta subunit

Synonyms: GBETA
UniProtKB ID: Q96I99, C9JVT2, O95195, Q6NUH7, Q86VX8, Q8WUQ1
Gene ID:
Human(8801) Summary: This gene encodes a GTP-specific beta subunit of succinyl-CoA synthetase. Succinyl-CoA synthetase catalyzes the reversible reaction involving the formation of succinyl-CoA and succinate. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 5 and 12. [provided by RefSeq, Apr 2010]
Mouse(20917) succinate-Coenzyme A ligase, GDP-forming, beta subunit
Rat(362404) succinate-CoA ligase, GDP-forming, beta subunit
cow(537713) succinate-CoA ligase, GDP-forming, beta subunit
sheep(101117623) succinate-CoA ligase, GDP-forming, beta subunit
naked mole-rat(101718468) succinate-CoA ligase, GDP-forming, beta subunit
Domestic Rabbit(100341093) succinate-CoA ligase, GDP-forming, beta subunit
domestic guinea pig(100720077) succinate-CoA ligase, GDP-forming, beta subunit
Zebrafish(317746) succinate-CoA ligase, GDP-forming, beta subunit
domestic cat(101088732) succinate-CoA ligase, GDP-forming, beta subunit
Horse(100063955) succinate-CoA ligase, GDP-forming, beta subunit
dog(476562) succinate-CoA ligase, GDP-forming, beta subunit
chicken(416087) succinate-CoA ligase, GDP-forming, beta subunit
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003848 Rosetta Predictions human pricing
NM_001100750 Rosetta Predictions rat pricing
NM_011507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106317 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210458 predicted 489
2 SASI_Rn02_00210459 predicted 843
3 SASI_Rn02_00210460 predicted 983
4 SASI_Rn02_00210461 predicted 1115
5 SASI_Rn02_00210462 predicted 701
6 SASI_Rn02_00210463 predicted 360
7 SASI_Rn02_00210464 predicted 901
8 SASI_Rn02_00210465 predicted 867
9 SASI_Rn02_00210466 predicted 830
10 SASI_Rn02_00210467 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106192 predicted 958
2 SASI_Mm01_00106193 predicted 402
3 SASI_Mm01_00106194 predicted 526
4 SASI_Mm01_00106195 predicted 1130
5 SASI_Mm01_00106196 predicted 546
6 SASI_Mm01_00106197 predicted 414
7 SASI_Mm01_00106198 predicted 510
8 SASI_Mm01_00106199 predicted 932
9 SASI_Mm01_00106200 predicted 425
10 SASI_Mm02_00320815 predicted 416
11 SASI_Mm01_00106201 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011507
SUCLG2 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, GDP-forming, beta subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-499s21c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011507.2-2093s21c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-613s21c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-933s21c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-577s1c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-1106s1c1
Sequence:CCGGCGTCAATATCTTTGGTGGGATCTCGAGATCCCACCAAAGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-897s1c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-463s1c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011507.1-2056s1c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011507
SUCLG2 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, GDP-forming, beta subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-499s21c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011507.2-2093s21c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-613s21c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-933s21c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-577s1c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-1106s1c1
Sequence:CCGGCGTCAATATCTTTGGTGGGATCTCGAGATCCCACCAAAGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-897s1c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-463s1c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011507.1-2056s1c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011507
SUCLG2 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, GDP-forming, beta subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-499s21c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011507.2-2093s21c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-613s21c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011507.2-933s21c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-577s1c1
Sequence:CCGGCCAGTCCAGAACTCATCTTTACTCGAGTAAAGATGAGTTCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-1106s1c1
Sequence:CCGGCGTCAATATCTTTGGTGGGATCTCGAGATCCCACCAAAGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-897s1c1
Sequence:CCGGGCCAGATACGATCTCAAGTATCTCGAGATACTTGAGATCGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011507.1-463s1c1
Sequence:CCGGCCCTGGATATTTCTAGAGAAACTCGAGTTTCTCTAGAAATATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011507.1-2056s1c1
Sequence:CCGGCCACCTCACATCTATCAGTTTCTCGAGAAACTGATAGATGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003848
VALIDATED
SUCLG2 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, GDP-forming, beta subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-181s21c1
Sequence:CCGGCAACGGAGTGAGAGTTCAAAGCTCGAGCTTTGAACTCTCACTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-137s21c1
Sequence:CCGGTGGCTGAACCTGCAGGAATACCTCGAGGTATTCCTGCAGGTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003848.2-2179s21c1
Sequence:CCGGCTCCCAGAATCTACCAGTTTACTCGAGTAAACTGGTAGATTCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-1778s21c1
Sequence:CCGGCTGAACATATTAGCTACTAAACTCGAGTTTAGTAGCTAATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-2127s21c1
Sequence:CCGGATTGTGTTTAGTATCACTATCCTCGAGGATAGTGATACTAAACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-977s1c1
Sequence:CCGGCCAGCCAACTTCTTGGATCTTCTCGAGAAGATCCAAGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-654s1c1
Sequence:CCGGGCCAGGCTGCAGATCAAATTACTCGAGTAATTTGATCTGCAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-431s1c1
Sequence:CCGGGCCTTGGATATTTCCAGAGAACTCGAGTTCTCTGGAAATATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003848.1-1621s1c1
Sequence:CCGGCCTGCTTCATTTACAAGAATTCTCGAGAATTCTTGTAAATGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-277s1c1
Sequence:CCGGAGGTGTCTTCAATAGTGGTTTCTCGAGAAACCACTATTGAAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003848
VALIDATED
SUCLG2 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, GDP-forming, beta subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-181s21c1
Sequence:CCGGCAACGGAGTGAGAGTTCAAAGCTCGAGCTTTGAACTCTCACTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-137s21c1
Sequence:CCGGTGGCTGAACCTGCAGGAATACCTCGAGGTATTCCTGCAGGTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003848.2-2179s21c1
Sequence:CCGGCTCCCAGAATCTACCAGTTTACTCGAGTAAACTGGTAGATTCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-1778s21c1
Sequence:CCGGCTGAACATATTAGCTACTAAACTCGAGTTTAGTAGCTAATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-2127s21c1
Sequence:CCGGATTGTGTTTAGTATCACTATCCTCGAGGATAGTGATACTAAACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-977s1c1
Sequence:CCGGCCAGCCAACTTCTTGGATCTTCTCGAGAAGATCCAAGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-654s1c1
Sequence:CCGGGCCAGGCTGCAGATCAAATTACTCGAGTAATTTGATCTGCAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-431s1c1
Sequence:CCGGGCCTTGGATATTTCCAGAGAACTCGAGTTCTCTGGAAATATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003848.1-1621s1c1
Sequence:CCGGCCTGCTTCATTTACAAGAATTCTCGAGAATTCTTGTAAATGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-277s1c1
Sequence:CCGGAGGTGTCTTCAATAGTGGTTTCTCGAGAAACCACTATTGAAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003848
VALIDATED
SUCLG2 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, GDP-forming, beta subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-181s21c1
Sequence:CCGGCAACGGAGTGAGAGTTCAAAGCTCGAGCTTTGAACTCTCACTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003848.2-137s21c1
Sequence:CCGGTGGCTGAACCTGCAGGAATACCTCGAGGTATTCCTGCAGGTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003848.2-2179s21c1
Sequence:CCGGCTCCCAGAATCTACCAGTTTACTCGAGTAAACTGGTAGATTCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-1778s21c1
Sequence:CCGGCTGAACATATTAGCTACTAAACTCGAGTTTAGTAGCTAATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003848.2-2127s21c1
Sequence:CCGGATTGTGTTTAGTATCACTATCCTCGAGGATAGTGATACTAAACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-977s1c1
Sequence:CCGGCCAGCCAACTTCTTGGATCTTCTCGAGAAGATCCAAGAAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-654s1c1
Sequence:CCGGGCCAGGCTGCAGATCAAATTACTCGAGTAATTTGATCTGCAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-431s1c1
Sequence:CCGGGCCTTGGATATTTCCAGAGAACTCGAGTTCTCTGGAAATATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003848.1-1621s1c1
Sequence:CCGGCCTGCTTCATTTACAAGAATTCTCGAGAATTCTTGTAAATGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003848.1-277s1c1
Sequence:CCGGAGGTGTCTTCAATAGTGGTTTCTCGAGAAACCACTATTGAAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks