EMAIL THIS PAGE TO A FRIEND

SUCLG2P2

succinate-CoA ligase, GDP-forming, beta subunit pseudogene 2

Species: Human SUCLG2P2(283398)
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_208658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_208658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_208658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718025 Rosetta Predictions human pricing
XM_208658 Rosetta Predictions human pricing
XM_931770 Rosetta Predictions human pricing
XM_942458 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421196 predicted 234
2 SASI_Hs02_00421197 predicted 1275
3 SASI_Hs02_00421198 predicted 396
4 SASI_Hs02_00421199 predicted 134
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478934 predicted 211
2 SASI_Hs01_00263537 predicted 1257
3 SASI_Hs01_00263538 predicted 383
4 SASI_Hs02_00478935 predicted 2
5 SASI_Hs02_00478936 predicted 119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260743 predicted 916
2 SASI_Hs01_00260744 predicted 207
3 SASI_Hs01_00260745 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485463 predicted 217
2 SASI_Hs02_00485464 predicted 1265
3 SASI_Hs02_00485465 predicted 380
4 SASI_Hs02_00485466 predicted 10
5 SASI_Hs02_00485467 predicted 117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208658
SUCLG2P2 MISSION shRNA Bacterial Glycerol Stock
succinate-CoA ligase, GDP-forming, beta subunit pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-44s1c1
Sequence:CCGGTCAAGGATGAATACAAGGAAACTCGAGTTTCCTTGTATTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-743s1c1
Sequence:CCGGCCTTGGACATTTCCAGAGAAACTCGAGTTTCTCTGGAAATGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-152s1c1
Sequence:CCGGAGCATCAGACACTAGAAACTTCTCGAGAAGTTTCTAGTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-990s1c1
Sequence:CCGGGCTGTATAATCTCTTCCTGAACTCGAGTTCAGGAAGAGATTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-460s1c1
Sequence:CCGGGATAACAGAGTGACAGTTCAACTCGAGTTGAACTGTCACTCTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208658
SUCLG2P2 MISSION shRNA shRNA Plasmid DNA
succinate-CoA ligase, GDP-forming, beta subunit pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-44s1c1
Sequence:CCGGTCAAGGATGAATACAAGGAAACTCGAGTTTCCTTGTATTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-743s1c1
Sequence:CCGGCCTTGGACATTTCCAGAGAAACTCGAGTTTCTCTGGAAATGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-152s1c1
Sequence:CCGGAGCATCAGACACTAGAAACTTCTCGAGAAGTTTCTAGTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-990s1c1
Sequence:CCGGGCTGTATAATCTCTTCCTGAACTCGAGTTCAGGAAGAGATTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-460s1c1
Sequence:CCGGGATAACAGAGTGACAGTTCAACTCGAGTTGAACTGTCACTCTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208658
SUCLG2P2 MISSION shRNA Lentiviral Transduction Particles
succinate-CoA ligase, GDP-forming, beta subunit pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-44s1c1
Sequence:CCGGTCAAGGATGAATACAAGGAAACTCGAGTTTCCTTGTATTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-743s1c1
Sequence:CCGGCCTTGGACATTTCCAGAGAAACTCGAGTTTCTCTGGAAATGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-152s1c1
Sequence:CCGGAGCATCAGACACTAGAAACTTCTCGAGAAGTTTCTAGTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-990s1c1
Sequence:CCGGGCTGTATAATCTCTTCCTGAACTCGAGTTCAGGAAGAGATTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208658.4-460s1c1
Sequence:CCGGGATAACAGAGTGACAGTTCAACTCGAGTTGAACTGTCACTCTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks