EMAIL THIS PAGE TO A FRIEND

SUCNR1

succinate receptor 1

Synonyms: GPR91
UniProtKB ID: Q9BXA5, A8K305, Q8TDQ8
Gene ID:
Human(56670) Summary: This gene encodes a G-protein-coupled receptor for succinate, an intermediate molecule of the citric acid cycle. It is involved in the promotion of hematopoietic progenitor cell development, and it has a potential role in renovascular hypertension which has known correlations to renal failure, diabetes and atherosclerosis. [provided by RefSeq, Oct 2009]
Mouse(84112) succinate receptor 1
Rat(408199) succinate receptor 1
chicken(771768) succinate receptor 1
dog(485719) succinate receptor 1
domestic cat(101096096) succinate receptor 1
domestic guinea pig(100723955) succinate receptor 1
cow(539622) succinate receptor 1
sheep(101122570) succinate receptor 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033050 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054081 MISSION® esiRNA esiRNA targeting mouse Sucnr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033050 Rosetta Predictions human pricing
NM_001001518 Rosetta Predictions rat pricing
NM_032400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191086 predicted 215
2 SASI_Hs01_00191087 predicted 392
3 SASI_Hs01_00191088 predicted 831
4 SASI_Hs01_00191089 predicted 1158
5 SASI_Hs01_00191090 predicted 445
6 SASI_Hs01_00191091 predicted 959
7 SASI_Hs02_00360743 predicted 1024
8 SASI_Hs01_00191093 predicted 444
9 SASI_Hs01_00191094 predicted 1023
10 SASI_Hs01_00191095 predicted 407
11 SASI_Hs01_00191092 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074226 predicted 726
2 SASI_Rn01_00074227 predicted 281
3 SASI_Rn01_00074228 predicted 518
4 SASI_Rn01_00074229 predicted 433
5 SASI_Rn01_00074231 predicted 727
6 SASI_Rn01_00074232 predicted 574
7 SASI_Rn02_00197921 predicted 228
8 SASI_Rn01_00074233 predicted 505
9 SASI_Rn01_00074234 predicted 301
10 SASI_Rn01_00074235 predicted 690
11 SASI_Rn01_00074230 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119723 predicted 642
2 SASI_Mm01_00119724 predicted 414
3 SASI_Mm01_00119725 predicted 655
4 SASI_Mm01_00119726 predicted 656
5 SASI_Mm01_00119727 predicted 866
6 SASI_Mm01_00119728 predicted 399
7 SASI_Mm01_00119729 predicted 297
8 SASI_Mm01_00119730 predicted 595
9 SASI_Mm01_00119731 predicted 333
10 SASI_Mm01_00119732 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032400
SUCNR1 MISSION shRNA Bacterial Glycerol Stock
succinate receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-580s1c1
Sequence:CCGGCGACTATGCAAGTTCTGGAAACTCGAGTTTCCAGAACTTGCATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032400.1-1427s1c1
Sequence:CCGGCGTGTTTCTGAAATAGTCTTACTCGAGTAAGACTATTTCAGAAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-295s1c1
Sequence:CCGGCCTGATAAAGAGTTATGCCAACTCGAGTTGGCATAACTCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-527s1c1
Sequence:CCGGCCCATGCTCACTTTCATCAATCTCGAGATTGATGAAAGTGAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-800s1c1
Sequence:CCGGCCCTATCATATCATGCGCAATCTCGAGATTGCGCATGATATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1389s21c1
Sequence:CCGGCATCATTGGTCAGGTCGATAACTCGAGTTATCGACCTGACCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032400.2-949s21c1
Sequence:CCGGAGAGAGATGCTGATTAGTAAGCTCGAGCTTACTAATCAGCATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1355s21c1
Sequence:CCGGACAAGATAGCTAGTTGCAAATCTCGAGATTTGCAACTAGCTATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032400
SUCNR1 MISSION shRNA shRNA Plasmid DNA
succinate receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-580s1c1
Sequence:CCGGCGACTATGCAAGTTCTGGAAACTCGAGTTTCCAGAACTTGCATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032400.1-1427s1c1
Sequence:CCGGCGTGTTTCTGAAATAGTCTTACTCGAGTAAGACTATTTCAGAAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-295s1c1
Sequence:CCGGCCTGATAAAGAGTTATGCCAACTCGAGTTGGCATAACTCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-527s1c1
Sequence:CCGGCCCATGCTCACTTTCATCAATCTCGAGATTGATGAAAGTGAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-800s1c1
Sequence:CCGGCCCTATCATATCATGCGCAATCTCGAGATTGCGCATGATATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1389s21c1
Sequence:CCGGCATCATTGGTCAGGTCGATAACTCGAGTTATCGACCTGACCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032400.2-949s21c1
Sequence:CCGGAGAGAGATGCTGATTAGTAAGCTCGAGCTTACTAATCAGCATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1355s21c1
Sequence:CCGGACAAGATAGCTAGTTGCAAATCTCGAGATTTGCAACTAGCTATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032400
SUCNR1 MISSION shRNA Lentiviral Transduction Particles
succinate receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-580s1c1
Sequence:CCGGCGACTATGCAAGTTCTGGAAACTCGAGTTTCCAGAACTTGCATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032400.1-1427s1c1
Sequence:CCGGCGTGTTTCTGAAATAGTCTTACTCGAGTAAGACTATTTCAGAAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-295s1c1
Sequence:CCGGCCTGATAAAGAGTTATGCCAACTCGAGTTGGCATAACTCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-527s1c1
Sequence:CCGGCCCATGCTCACTTTCATCAATCTCGAGATTGATGAAAGTGAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032400.1-800s1c1
Sequence:CCGGCCCTATCATATCATGCGCAATCTCGAGATTGCGCATGATATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1389s21c1
Sequence:CCGGCATCATTGGTCAGGTCGATAACTCGAGTTATCGACCTGACCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032400.2-949s21c1
Sequence:CCGGAGAGAGATGCTGATTAGTAAGCTCGAGCTTACTAATCAGCATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032400.2-1355s21c1
Sequence:CCGGACAAGATAGCTAGTTGCAAATCTCGAGATTTGCAACTAGCTATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033050
VALIDATED
SUCNR1 MISSION shRNA Bacterial Glycerol Stock
succinate receptor 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033050.1-1103s1c1
Sequence:CCGGCCTTAACTCATAGACATCAATCTCGAGATTGATGTCTATGAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-321s1c1
Sequence:CCGGGCTCTGCATAAGCAACCGATACTCGAGTATCGGTTGCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-271s1c1
Sequence:CCGGCCCATGCTGATAAGGAGTTATCTCGAGATAACTCCTTATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-180s1c1
Sequence:CCGGCGGCTACATCTTCTCTCTGAACTCGAGTTCAGAGAGAAGATGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-729s1c1
Sequence:CCGGGCCTCTCAACTTGGTCATCATCTCGAGATGATGACCAAGTTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033050.3-454s21c1
Sequence:CCGGGATCGATACTTGATAATTAAGCTCGAGCTTAATTATCAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-402s21c1
Sequence:CCGGGCTTCATGCCAACCTCTATACCTCGAGGTATAGAGGTTGGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1193s21c1
Sequence:CCGGCAGATTTAACCTTGATCTAAACTCGAGTTTAGATCAAGGTTAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-349s21c1
Sequence:CCGGGCCAATGGAAACTGGATATATCTCGAGATATATCCAGTTTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-603s21c1
Sequence:CCGGTGGCACCACCTGTAATGATTTCTCGAGAAATCATTACAGGTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1068s21c1
Sequence:CCGGGGCTCATGAACTCCTACTTTCCTCGAGGAAAGTAGGAGTTCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-379s21c1
Sequence:CCGGCTCTGCATAAGCAACCGATATCTCGAGATATCGGTTGCTTATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-258s21c1
Sequence:CCGGGAACTGGAACAGCAGTAATATCTCGAGATATTACTGCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033050
VALIDATED
SUCNR1 MISSION shRNA shRNA Plasmid DNA
succinate receptor 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033050.1-1103s1c1
Sequence:CCGGCCTTAACTCATAGACATCAATCTCGAGATTGATGTCTATGAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-321s1c1
Sequence:CCGGGCTCTGCATAAGCAACCGATACTCGAGTATCGGTTGCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-271s1c1
Sequence:CCGGCCCATGCTGATAAGGAGTTATCTCGAGATAACTCCTTATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-180s1c1
Sequence:CCGGCGGCTACATCTTCTCTCTGAACTCGAGTTCAGAGAGAAGATGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-729s1c1
Sequence:CCGGGCCTCTCAACTTGGTCATCATCTCGAGATGATGACCAAGTTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033050.3-454s21c1
Sequence:CCGGGATCGATACTTGATAATTAAGCTCGAGCTTAATTATCAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-402s21c1
Sequence:CCGGGCTTCATGCCAACCTCTATACCTCGAGGTATAGAGGTTGGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1193s21c1
Sequence:CCGGCAGATTTAACCTTGATCTAAACTCGAGTTTAGATCAAGGTTAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-349s21c1
Sequence:CCGGGCCAATGGAAACTGGATATATCTCGAGATATATCCAGTTTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-603s21c1
Sequence:CCGGTGGCACCACCTGTAATGATTTCTCGAGAAATCATTACAGGTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1068s21c1
Sequence:CCGGGGCTCATGAACTCCTACTTTCCTCGAGGAAAGTAGGAGTTCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-379s21c1
Sequence:CCGGCTCTGCATAAGCAACCGATATCTCGAGATATCGGTTGCTTATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-258s21c1
Sequence:CCGGGAACTGGAACAGCAGTAATATCTCGAGATATTACTGCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033050
VALIDATED
SUCNR1 MISSION shRNA Lentiviral Transduction Particles
succinate receptor 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033050.1-1103s1c1
Sequence:CCGGCCTTAACTCATAGACATCAATCTCGAGATTGATGTCTATGAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-321s1c1
Sequence:CCGGGCTCTGCATAAGCAACCGATACTCGAGTATCGGTTGCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-271s1c1
Sequence:CCGGCCCATGCTGATAAGGAGTTATCTCGAGATAACTCCTTATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-180s1c1
Sequence:CCGGCGGCTACATCTTCTCTCTGAACTCGAGTTCAGAGAGAAGATGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033050.1-729s1c1
Sequence:CCGGGCCTCTCAACTTGGTCATCATCTCGAGATGATGACCAAGTTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033050.3-454s21c1
Sequence:CCGGGATCGATACTTGATAATTAAGCTCGAGCTTAATTATCAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-402s21c1
Sequence:CCGGGCTTCATGCCAACCTCTATACCTCGAGGTATAGAGGTTGGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1193s21c1
Sequence:CCGGCAGATTTAACCTTGATCTAAACTCGAGTTTAGATCAAGGTTAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-349s21c1
Sequence:CCGGGCCAATGGAAACTGGATATATCTCGAGATATATCCAGTTTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-603s21c1
Sequence:CCGGTGGCACCACCTGTAATGATTTCTCGAGAAATCATTACAGGTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-1068s21c1
Sequence:CCGGGGCTCATGAACTCCTACTTTCCTCGAGGAAAGTAGGAGTTCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-379s21c1
Sequence:CCGGCTCTGCATAAGCAACCGATATCTCGAGATATCGGTTGCTTATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_033050.3-258s21c1
Sequence:CCGGGAACTGGAACAGCAGTAATATCTCGAGATATTACTGCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks