EMAIL THIS PAGE TO A FRIEND

SUCO

SUN domain containing ossification factor

Synonyms: C1orf9 CH1 OPT SLP1
UniProtKB ID: Q9UBS9, B2RNU4, Q9BQB9, Q9BXQ2, Q9UL04
Gene ID:
Mouse(226551) SUN domain containing ossification factor
Rat(360863) SUN domain containing ossification factor
cow(520588) SUN domain containing ossification factor
sheep(101108241) SUN domain containing ossification factor
domestic guinea pig(100733531) SUN domain containing ossification factor
naked mole-rat(101699006) SUN domain containing ossification factor
Zebrafish(558218) SUN domain containing ossification factor
dog(480071) SUN domain containing ossification factor
domestic cat(101091496) SUN domain containing ossification factor
232 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047251 Anti-SUCO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014283 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014283 Rosetta Predictions human pricing
NM_016227 Rosetta Predictions human pricing
NM_199403 Rosetta Predictions rat pricing
XM_001074497 Rosetta Predictions rat pricing
XM_001479494 Rosetta Predictions mouse pricing
XM_975051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345362 predicted 1807
2 SASI_Hs02_00345363 predicted 3060
3 SASI_Hs01_00195223 predicted 3848
4 SASI_Hs01_00195225 predicted 3498
5 SASI_Hs01_00195227 predicted 3752
6 SASI_Hs01_00195228 predicted 1963
7 SASI_Hs02_00345364 predicted 4130
8 SASI_Hs02_00345365 predicted 3973
9 SASI_Hs02_00345366 predicted 3276
10 SASI_Hs02_00345367 predicted 2994
11 SASI_Hs01_00195224 predicted 3629
12 SASI_Hs01_00195226 predicted 3675
13 SASI_Hs01_00195229 predicted 3334
14 SASI_Hs01_00195230 predicted 3457
15 SASI_Hs01_00195231 predicted 3434
16 SASI_Hs01_00195232 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349088 predicted 1613
2 SASI_Hs02_00349089 predicted 2869
3 SASI_Hs01_00201947 predicted 3659
4 SASI_Hs01_00201949 predicted 3310
5 SASI_Hs01_00201951 predicted 3563
6 SASI_Hs01_00201952 predicted 1772
7 SASI_Hs02_00349090 predicted 3940
8 SASI_Hs02_00349091 predicted 3781
9 SASI_Hs02_00349092 predicted 3081
10 SASI_Hs02_00349093 predicted 2808
11 SASI_Hs01_00201948 predicted 3989
12 SASI_Hs01_00201950 predicted 4034
13 SASI_Hs01_00201953 predicted 3688
14 SASI_Hs01_00201954 predicted 3813
15 SASI_Hs01_00201955 predicted 3784
16 SASI_Hs01_00201956 predicted 2310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055769 predicted 3535
2 SASI_Rn01_00055770 predicted 2754
3 SASI_Rn01_00055771 predicted 703
4 SASI_Rn01_00055772 predicted 2330
5 SASI_Rn01_00055773 predicted 2375
6 SASI_Rn01_00055774 predicted 3034
7 SASI_Rn01_00055775 predicted 1622
8 SASI_Rn01_00055776 predicted 1857
9 SASI_Rn01_00055778 predicted 2819
10 SASI_Rn02_00270230 predicted 3261
11 SASI_Rn01_00055777 predicted 3187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346466 predicted 3432
2 SASI_Rn02_00346467 predicted 3013
3 SASI_Rn02_00346468 predicted 3053
4 SASI_Rn02_00346469 predicted 3717
5 SASI_Rn02_00346470 predicted 2300
6 SASI_Rn02_00346471 predicted 3499
7 SASI_Rn02_00346472 predicted 1257
8 SASI_Rn02_00346473 predicted 1220
9 SASI_Rn02_00346474 predicted 3940
10 SASI_Rn02_00346475 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410403 predicted 4161
2 SASI_Mm02_00410404 predicted 2130
3 SASI_Mm02_00410405 predicted 3816
4 SASI_Mm02_00410406 predicted 816
5 SASI_Mm02_00410407 predicted 3657
6 SASI_Mm02_00410408 predicted 2850
7 SASI_Mm02_00410409 predicted 3160
8 SASI_Mm02_00410410 predicted 3426
9 SASI_Mm02_00410411 predicted 3013
10 SASI_Mm02_00410412 predicted 4071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281017 predicted 4168
2 SASI_Mm01_00281018 predicted 2128
3 SASI_Mm01_00281019 predicted 3810
4 SASI_Mm01_00281020 predicted 820
5 SASI_Mm01_00281021 predicted 3656
6 SASI_Mm01_00281022 predicted 2850
7 SASI_Mm01_00281023 predicted 3163
8 SASI_Mm01_00281024 predicted 3434
9 SASI_Mm02_00445489 predicted 3017
10 SASI_Mm01_00281025 predicted 4066
11 SASI_Mm01_00281026 predicted 3620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172645
VALIDATED
SUCO MISSION shRNA Bacterial Glycerol Stock
SUN domain containing ossification factor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4545s21c1
Sequence:CCGGGCTCAGCAATGTGGGTCATTTCTCGAGAAATGACCCACATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2548s21c1
Sequence:CCGGTAAATCTGAAGGAGGATATATCTCGAGATATATCCTCCTTCAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2821s21c1
Sequence:CCGGTAGTATAGCTGATACACTAAACTCGAGTTTAGTGTATCAGCTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4391s21c1
Sequence:CCGGTCTTGCACCTTCCCATATTTACTCGAGTAAATATGGGAAGGTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-1617s21c1
Sequence:CCGGTTTGTCCTTTAAGCCTAATAACTCGAGTTATTAGGCTTAAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-1582s21c1
Sequence:CCGGGGTGGAGCTGCTATCACATTTCTCGAGAAATGTGATAGCAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-3027s21c1
Sequence:CCGGCAGTATTTATGAGGCTTAATACTCGAGTATTAAGCCTCATAAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172645
VALIDATED
SUCO MISSION shRNA shRNA Plasmid DNA
SUN domain containing ossification factor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4545s21c1
Sequence:CCGGGCTCAGCAATGTGGGTCATTTCTCGAGAAATGACCCACATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2548s21c1
Sequence:CCGGTAAATCTGAAGGAGGATATATCTCGAGATATATCCTCCTTCAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2821s21c1
Sequence:CCGGTAGTATAGCTGATACACTAAACTCGAGTTTAGTGTATCAGCTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4391s21c1
Sequence:CCGGTCTTGCACCTTCCCATATTTACTCGAGTAAATATGGGAAGGTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-1617s21c1
Sequence:CCGGTTTGTCCTTTAAGCCTAATAACTCGAGTTATTAGGCTTAAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-1582s21c1
Sequence:CCGGGGTGGAGCTGCTATCACATTTCTCGAGAAATGTGATAGCAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-3027s21c1
Sequence:CCGGCAGTATTTATGAGGCTTAATACTCGAGTATTAAGCCTCATAAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172645
VALIDATED
SUCO MISSION shRNA Lentiviral Transduction Particles
SUN domain containing ossification factor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4545s21c1
Sequence:CCGGGCTCAGCAATGTGGGTCATTTCTCGAGAAATGACCCACATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2548s21c1
Sequence:CCGGTAAATCTGAAGGAGGATATATCTCGAGATATATCCTCCTTCAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-2821s21c1
Sequence:CCGGTAGTATAGCTGATACACTAAACTCGAGTTTAGTGTATCAGCTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-4391s21c1
Sequence:CCGGTCTTGCACCTTCCCATATTTACTCGAGTAAATATGGGAAGGTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-1617s21c1
Sequence:CCGGTTTGTCCTTTAAGCCTAATAACTCGAGTTATTAGGCTTAAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172645.2-1582s21c1
Sequence:CCGGGGTGGAGCTGCTATCACATTTCTCGAGAAATGTGATAGCAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172645.2-3027s21c1
Sequence:CCGGCAGTATTTATGAGGCTTAATACTCGAGTATTAAGCCTCATAAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014283
VALIDATED
SUCO MISSION shRNA Bacterial Glycerol Stock
SUN domain containing ossification factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-3702s21c1
Sequence:CCGGCCATAGCCAATGGCGACATAACTCGAGTTATGTCGCCATTGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1600s21c1
Sequence:CCGGGGTTGAGTTGCTATCACATTTCTCGAGAAATGTGATAGCAACTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1643s21c1
Sequence:CCGGTTAAGCCTTATAAGGGTATTTCTCGAGAAATACCCTTATAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014283.3-4286s21c1
Sequence:CCGGTAAGGACAATGGTAGACATTTCTCGAGAAATGTCTACCATTGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1746s21c1
Sequence:CCGGATGATTATCCACTGGATTATACTCGAGTATAATCCAGTGGATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-328s1c1
Sequence:CCGGGCGTCATCATATTACTCTCAACTCGAGTTGAGAGTAATATGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3220s1c1
Sequence:CCGGGCAGAATTGAAACGGGAGGTTCTCGAGAACCTCCCGTTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3941s1c1
Sequence:CCGGCCGTGGGAACATTTGGTGTTACTCGAGTAACACCAAATGTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014283.2-2213s1c1
Sequence:CCGGCCTTACTACTTCCTGCGGAATCTCGAGATTCCGCAGGAAGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-1012s1c1
Sequence:CCGGCCAGAAGATATACCAACATTTCTCGAGAAATGTTGGTATATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014283
VALIDATED
SUCO MISSION shRNA shRNA Plasmid DNA
SUN domain containing ossification factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-3702s21c1
Sequence:CCGGCCATAGCCAATGGCGACATAACTCGAGTTATGTCGCCATTGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1600s21c1
Sequence:CCGGGGTTGAGTTGCTATCACATTTCTCGAGAAATGTGATAGCAACTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1643s21c1
Sequence:CCGGTTAAGCCTTATAAGGGTATTTCTCGAGAAATACCCTTATAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014283.3-4286s21c1
Sequence:CCGGTAAGGACAATGGTAGACATTTCTCGAGAAATGTCTACCATTGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1746s21c1
Sequence:CCGGATGATTATCCACTGGATTATACTCGAGTATAATCCAGTGGATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-328s1c1
Sequence:CCGGGCGTCATCATATTACTCTCAACTCGAGTTGAGAGTAATATGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3220s1c1
Sequence:CCGGGCAGAATTGAAACGGGAGGTTCTCGAGAACCTCCCGTTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3941s1c1
Sequence:CCGGCCGTGGGAACATTTGGTGTTACTCGAGTAACACCAAATGTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014283.2-2213s1c1
Sequence:CCGGCCTTACTACTTCCTGCGGAATCTCGAGATTCCGCAGGAAGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-1012s1c1
Sequence:CCGGCCAGAAGATATACCAACATTTCTCGAGAAATGTTGGTATATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014283
VALIDATED
SUCO MISSION shRNA Lentiviral Transduction Particles
SUN domain containing ossification factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-3702s21c1
Sequence:CCGGCCATAGCCAATGGCGACATAACTCGAGTTATGTCGCCATTGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1600s21c1
Sequence:CCGGGGTTGAGTTGCTATCACATTTCTCGAGAAATGTGATAGCAACTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1643s21c1
Sequence:CCGGTTAAGCCTTATAAGGGTATTTCTCGAGAAATACCCTTATAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014283.3-4286s21c1
Sequence:CCGGTAAGGACAATGGTAGACATTTCTCGAGAAATGTCTACCATTGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014283.3-1746s21c1
Sequence:CCGGATGATTATCCACTGGATTATACTCGAGTATAATCCAGTGGATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-328s1c1
Sequence:CCGGGCGTCATCATATTACTCTCAACTCGAGTTGAGAGTAATATGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3220s1c1
Sequence:CCGGGCAGAATTGAAACGGGAGGTTCTCGAGAACCTCCCGTTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-3941s1c1
Sequence:CCGGCCGTGGGAACATTTGGTGTTACTCGAGTAACACCAAATGTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014283.2-2213s1c1
Sequence:CCGGCCTTACTACTTCCTGCGGAATCTCGAGATTCCGCAGGAAGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014283.2-1012s1c1
Sequence:CCGGCCAGAAGATATACCAACATTTCTCGAGAAATGTTGGTATATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks