EMAIL THIS PAGE TO A FRIEND

SUDS3

suppressor of defective silencing 3 homolog (S. cerevisiae)

Synonyms: SAP45 SDS3
UniProtKB ID: Q9H7L9, Q4KMQ5, Q8N6H0, Q9H8D2
Gene ID:
Human(64426) Summary: SDS3 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]
Mouse(71954) suppressor of defective silencing 3 homolog (S. cerevisiae)
Rat(360819) suppressor of defective silencing 3 homolog (S. cerevisiae)
Zebrafish(445099) suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)
chicken(427713) suppressor of defective silencing 3 homolog (S. cerevisiae)
domestic cat(101093302) suppressor of defective silencing 3 homolog (S. cerevisiae)
dog(486293) suppressor of defective silencing 3 homolog (S. cerevisiae)
naked mole-rat(101720745) suppressor of defective silencing 3 homolog (S. cerevisiae)
domestic guinea pig(100726433) suppressor of defective silencing 3 homolog (S. cerevisiae)
cow(506646) suppressor of defective silencing 3 homolog (S. cerevisiae)
sheep(101106797) suppressor of defective silencing 3 homolog (S. cerevisiae)
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022491 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110241 MISSION® esiRNA esiRNA human SUDS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022491 Rosetta Predictions human pricing
XM_001080131 Rosetta Predictions rat pricing
XM_341092 Rosetta Predictions rat pricing
NM_001122666 Rosetta Predictions mouse pricing
NM_178622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125884 predicted 633
2 SASI_Hs01_00125885 predicted 894
3 SASI_Hs01_00125886 predicted 652
4 SASI_Hs01_00125888 predicted 491
5 SASI_Hs01_00125889 predicted 652
6 SASI_Hs01_00125890 predicted 748
7 SASI_Hs01_00125891 predicted 779
8 SASI_Hs01_00125892 predicted 315
9 SASI_Hs01_00125893 predicted 344
10 SASI_Hs02_00355798 predicted 320
11 SASI_Hs01_00125887 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366745 predicted 2352
2 SASI_Rn02_00366746 predicted 1987
3 SASI_Rn02_00366747 predicted 1296
4 SASI_Rn02_00366748 predicted 2017
5 SASI_Rn02_00366749 predicted 940
6 SASI_Rn02_00366750 predicted 1256
7 SASI_Rn02_00366751 predicted 2210
8 SASI_Rn02_00366752 predicted 2390
9 SASI_Rn02_00366753 predicted 2243
10 SASI_Rn02_00366754 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392331 predicted 2348
2 SASI_Rn02_00392332 predicted 1989
3 SASI_Rn02_00392333 predicted 1294
4 SASI_Rn02_00392334 predicted 2020
5 SASI_Rn02_00392335 predicted 943
6 SASI_Rn02_00392336 predicted 1260
7 SASI_Rn02_00392337 predicted 2216
8 SASI_Rn02_00392338 predicted 2385
9 SASI_Rn02_00392339 predicted 2246
10 SASI_Rn02_00392340 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309180 predicted 1291
2 SASI_Mm02_00309181 predicted 685
3 SASI_Mm02_00309182 predicted 1442
4 SASI_Mm02_00309183 predicted 1415
5 SASI_Mm02_00309184 predicted 933
6 SASI_Mm02_00309185 predicted 385
7 SASI_Mm02_00309186 predicted 442
8 SASI_Mm02_00309187 predicted 1464
9 SASI_Mm02_00309188 predicted 598
10 SASI_Mm02_00309189 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059916 predicted 693
2 SASI_Mm01_00059917 predicted 1531
3 SASI_Mm01_00059918 predicted 1507
4 SASI_Mm01_00059919 predicted 935
5 SASI_Mm01_00059920 predicted 386
6 SASI_Mm01_00059921 predicted 441
7 SASI_Mm01_00059922 predicted 1549
8 SASI_Mm01_00059923 predicted 592
9 SASI_Mm01_00059924 predicted 963
10 SASI_Mm01_00059925 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178622
VALIDATED
SUDS3 MISSION shRNA Bacterial Glycerol Stock
suppressor of defective silencing 3 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-328s1c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178622.3-702s1c1
Sequence:CCGGCATTCCAGACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-603s1c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-945s1c1
Sequence:CCGGCTACCTGGAATCTAAGGACAACTCGAGTTGTCCTTAGATTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-490s1c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-1541s21c1
Sequence:CCGGGGTATGCTTTCCCGCCTAATCCTCGAGGATTAGGCGGGAAAGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-841s21c1
Sequence:CCGGAGGACGCTGAACAAGCTTAAGCTCGAGCTTAAGCTTGTTCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-388s21c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-663s21c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-550s21c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178622
VALIDATED
SUDS3 MISSION shRNA shRNA Plasmid DNA
suppressor of defective silencing 3 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-328s1c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178622.3-702s1c1
Sequence:CCGGCATTCCAGACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-603s1c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-945s1c1
Sequence:CCGGCTACCTGGAATCTAAGGACAACTCGAGTTGTCCTTAGATTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-490s1c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-1541s21c1
Sequence:CCGGGGTATGCTTTCCCGCCTAATCCTCGAGGATTAGGCGGGAAAGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-841s21c1
Sequence:CCGGAGGACGCTGAACAAGCTTAAGCTCGAGCTTAAGCTTGTTCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-388s21c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-663s21c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-550s21c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178622
VALIDATED
SUDS3 MISSION shRNA Lentiviral Transduction Particles
suppressor of defective silencing 3 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-328s1c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178622.3-702s1c1
Sequence:CCGGCATTCCAGACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-603s1c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-945s1c1
Sequence:CCGGCTACCTGGAATCTAAGGACAACTCGAGTTGTCCTTAGATTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178622.3-490s1c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-1541s21c1
Sequence:CCGGGGTATGCTTTCCCGCCTAATCCTCGAGGATTAGGCGGGAAAGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-841s21c1
Sequence:CCGGAGGACGCTGAACAAGCTTAAGCTCGAGCTTAAGCTTGTTCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-388s21c1
Sequence:CCGGGAACAGATGTATCAGGACAAACTCGAGTTTGTCCTGATACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-663s21c1
Sequence:CCGGCGAGAACGAGAAACTCACCATCTCGAGATGGTGAGTTTCTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178622.4-550s21c1
Sequence:CCGGGTGGAGAGGAATTACATTAAACTCGAGTTTAATGTAATTCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022491
VALIDATED
SUDS3 MISSION shRNA Bacterial Glycerol Stock
suppressor of defective silencing 3 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-228s1c1
Sequence:CCGGGCCCAGCTAAACTATTTGTTACTCGAGTAACAAATAGTTTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-540s1c1
Sequence:CCGGAGGATCTACCTGGGCCAGCTTCTCGAGAAGCTGGCCCAGGTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-349s1c1
Sequence:CCGGCCGCGGAATCTCCAGCCCAGACTCGAGTCTGGGCTGGAGATTCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022491.1-142s1c1
Sequence:CCGGAGGTGAAACCTATCATGACCACTCGAGTGGTCATGATAGGTTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-378s1c1
Sequence:CCGGGCTCGGATAGAAGATGGCAAACTCGAGTTTGCCATCTTCTATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-502s21c1
Sequence:CCGGTGAACAAGTGGAACGAAATTACTCGAGTAATTTCGTTCCACTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022491.2-3225s21c1
Sequence:CCGGGCGTCCTCACAACTCTTAATTCTCGAGAATTAAGAGTTGTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-395s21c1
Sequence:GTACCGGCAACTGCAAGAAGGTACATTACTCGAGTAATGTACCTTCTTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-790s21c1
Sequence:GTACCGGGGAGGATCTGAGAACATTAAACTCGAGTTTAATGTTCTCAGATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-948s21c1
Sequence:CCGGACAAGAGCCAGGCCATCTATCCTCGAGGATAGATGGCCTGGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022491
VALIDATED
SUDS3 MISSION shRNA shRNA Plasmid DNA
suppressor of defective silencing 3 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-228s1c1
Sequence:CCGGGCCCAGCTAAACTATTTGTTACTCGAGTAACAAATAGTTTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-540s1c1
Sequence:CCGGAGGATCTACCTGGGCCAGCTTCTCGAGAAGCTGGCCCAGGTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-349s1c1
Sequence:CCGGCCGCGGAATCTCCAGCCCAGACTCGAGTCTGGGCTGGAGATTCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022491.1-142s1c1
Sequence:CCGGAGGTGAAACCTATCATGACCACTCGAGTGGTCATGATAGGTTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-378s1c1
Sequence:CCGGGCTCGGATAGAAGATGGCAAACTCGAGTTTGCCATCTTCTATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-502s21c1
Sequence:CCGGTGAACAAGTGGAACGAAATTACTCGAGTAATTTCGTTCCACTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022491.2-3225s21c1
Sequence:CCGGGCGTCCTCACAACTCTTAATTCTCGAGAATTAAGAGTTGTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-395s21c1
Sequence:GTACCGGCAACTGCAAGAAGGTACATTACTCGAGTAATGTACCTTCTTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-790s21c1
Sequence:GTACCGGGGAGGATCTGAGAACATTAAACTCGAGTTTAATGTTCTCAGATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-948s21c1
Sequence:CCGGACAAGAGCCAGGCCATCTATCCTCGAGGATAGATGGCCTGGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022491
VALIDATED
SUDS3 MISSION shRNA Lentiviral Transduction Particles
suppressor of defective silencing 3 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-228s1c1
Sequence:CCGGGCCCAGCTAAACTATTTGTTACTCGAGTAACAAATAGTTTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-540s1c1
Sequence:CCGGAGGATCTACCTGGGCCAGCTTCTCGAGAAGCTGGCCCAGGTAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-349s1c1
Sequence:CCGGCCGCGGAATCTCCAGCCCAGACTCGAGTCTGGGCTGGAGATTCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022491.1-142s1c1
Sequence:CCGGAGGTGAAACCTATCATGACCACTCGAGTGGTCATGATAGGTTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022491.1-378s1c1
Sequence:CCGGGCTCGGATAGAAGATGGCAAACTCGAGTTTGCCATCTTCTATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-502s21c1
Sequence:CCGGTGAACAAGTGGAACGAAATTACTCGAGTAATTTCGTTCCACTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022491.2-3225s21c1
Sequence:CCGGGCGTCCTCACAACTCTTAATTCTCGAGAATTAAGAGTTGTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-395s21c1
Sequence:GTACCGGCAACTGCAAGAAGGTACATTACTCGAGTAATGTACCTTCTTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-790s21c1
Sequence:GTACCGGGGAGGATCTGAGAACATTAAACTCGAGTTTAATGTTCTCAGATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022491.2-948s21c1
Sequence:CCGGACAAGAGCCAGGCCATCTATCCTCGAGGATAGATGGCCTGGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks