EMAIL THIS PAGE TO A FRIEND

SUFU

suppressor of fused homolog (Drosophila)

Synonyms: PRO1280 SUFUH SUFUXL
Gene ID:
Human(51684) Summary: The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(24069) suppressor of fused homolog (Drosophila)
Rat(361769) suppressor of fused homolog (Drosophila)
Zebrafish(100001615) suppressor of fused homolog (Drosophila)
chicken(374118) suppressor of fused homolog (Drosophila)
Horse(100059929) suppressor of fused homolog (Drosophila)
domestic cat(101085156) suppressor of fused homolog (Drosophila)
dog(608531) suppressor of fused homolog (Drosophila)
cow(535067) suppressor of fused homolog (Drosophila)
sheep(101114993) suppressor of fused homolog (Drosophila)
domestic guinea pig(100732406) suppressor of fused homolog (Drosophila)
naked mole-rat(101724636) suppressor of fused homolog (Drosophila)
Domestic Rabbit(100345361) suppressor of fused homolog (Drosophila)
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006581 MISSION® esiRNA esiRNA targeting human SUFU (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016169 Rosetta Predictions human pricing
NM_001024899 Rosetta Predictions rat pricing
NM_001025391 Rosetta Predictions mouse pricing
NM_015752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348983 predicted 1646
2 SASI_Hs01_00144720 predicted 862
3 SASI_Hs01_00144721 predicted 1310
4 SASI_Hs01_00144722 predicted 689
5 SASI_Hs01_00144723 predicted 1345
6 SASI_Hs01_00144724 predicted 1671
7 SASI_Hs01_00144725 predicted 1805
8 SASI_Hs01_00144726 predicted 925
9 SASI_Hs01_00144727 predicted 1421
10 SASI_Hs01_00144728 predicted 2061
11 SASI_Hs01_00144719 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077585 predicted 603
2 SASI_Rn01_00077586 predicted 509
3 SASI_Rn01_00077587 predicted 1503
4 SASI_Rn01_00077588 predicted 668
5 SASI_Rn01_00077589 predicted 1372
6 SASI_Rn01_00077591 predicted 1146
7 SASI_Rn01_00077592 predicted 1459
8 SASI_Rn01_00077593 predicted 899
9 SASI_Rn02_00202799 predicted 459
10 SASI_Rn02_00202800 predicted 1430
11 SASI_Rn01_00077590 predicted 1271
12 SASI_Rn01_00077594 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160238 predicted 332
2 SASI_Mm01_00160239 predicted 616
3 SASI_Mm01_00160240 predicted 516
4 SASI_Mm02_00287863 predicted 1546
5 SASI_Mm01_00160242 predicted 1211
6 SASI_Mm02_00287864 predicted 1471
7 SASI_Mm01_00160243 predicted 1161
8 SASI_Mm01_00160245 predicted 1138
9 SASI_Mm01_00160246 predicted 487
10 SASI_Mm01_00160247 predicted 385
11 SASI_Mm01_00160241 predicted 684
12 SASI_Mm01_00160244 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185702 predicted 336
2 SASI_Mm01_00185703 predicted 618
3 SASI_Mm01_00185704 predicted 521
4 SASI_Mm02_00323080 predicted 1541
5 SASI_Mm01_00185706 predicted 1215
6 SASI_Mm02_00323081 predicted 1469
7 SASI_Mm01_00185707 predicted 1158
8 SASI_Mm01_00185709 predicted 1141
9 SASI_Mm01_00185710 predicted 479
10 SASI_Mm01_00185711 predicted 388
11 SASI_Mm01_00185705 predicted 691
12 SASI_Mm01_00185708 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016169
VALIDATED
SUFU MISSION shRNA Bacterial Glycerol Stock
suppressor of fused homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1426s21c1
Sequence:CCGGATGGACCCTGGTTACAAATTCCTCGAGGAATTTGTAACCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-424s21c1
Sequence:CCGGTCGGCCTGAGTGATCTCTATGCTCGAGCATAGAGATCACTCAGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1319s21c1
Sequence:CCGGTGGACGGCACTTTACATATAACTCGAGTTATATGTAAAGTGCCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016169.2-1675s21c1
Sequence:CCGGCAACGAGATCTCCACAAATAACTCGAGTTATTTGTGGAGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-896s1c1
Sequence:CCGGCCTGCAAGAGAGAGTTGACAACTCGAGTTGTCAACTCTCTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016169.2-643s1c1
Sequence:CCGGCTTTGGATAACAGTGAGTCAACTCGAGTTGACTCACTGTTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-1451s1c1
Sequence:CCGGGACCGAAGAGTTTGTAGAGAACTCGAGTTCTCTACAAACTCTTCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016169.2-1236s1c1
Sequence:CCGGCGGCAGCTTGAGAGCGTACATCTCGAGATGTACGCTCTCAAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-508s1c1
Sequence:CCGGCCTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016169
VALIDATED
SUFU MISSION shRNA shRNA Plasmid DNA
suppressor of fused homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1426s21c1
Sequence:CCGGATGGACCCTGGTTACAAATTCCTCGAGGAATTTGTAACCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-424s21c1
Sequence:CCGGTCGGCCTGAGTGATCTCTATGCTCGAGCATAGAGATCACTCAGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1319s21c1
Sequence:CCGGTGGACGGCACTTTACATATAACTCGAGTTATATGTAAAGTGCCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016169.2-1675s21c1
Sequence:CCGGCAACGAGATCTCCACAAATAACTCGAGTTATTTGTGGAGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-896s1c1
Sequence:CCGGCCTGCAAGAGAGAGTTGACAACTCGAGTTGTCAACTCTCTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016169.2-643s1c1
Sequence:CCGGCTTTGGATAACAGTGAGTCAACTCGAGTTGACTCACTGTTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-1451s1c1
Sequence:CCGGGACCGAAGAGTTTGTAGAGAACTCGAGTTCTCTACAAACTCTTCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016169.2-1236s1c1
Sequence:CCGGCGGCAGCTTGAGAGCGTACATCTCGAGATGTACGCTCTCAAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-508s1c1
Sequence:CCGGCCTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016169
VALIDATED
SUFU MISSION shRNA Lentiviral Transduction Particles
suppressor of fused homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1426s21c1
Sequence:CCGGATGGACCCTGGTTACAAATTCCTCGAGGAATTTGTAACCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-424s21c1
Sequence:CCGGTCGGCCTGAGTGATCTCTATGCTCGAGCATAGAGATCACTCAGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016169.2-1319s21c1
Sequence:CCGGTGGACGGCACTTTACATATAACTCGAGTTATATGTAAAGTGCCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016169.2-1675s21c1
Sequence:CCGGCAACGAGATCTCCACAAATAACTCGAGTTATTTGTGGAGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-896s1c1
Sequence:CCGGCCTGCAAGAGAGAGTTGACAACTCGAGTTGTCAACTCTCTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016169.2-643s1c1
Sequence:CCGGCTTTGGATAACAGTGAGTCAACTCGAGTTGACTCACTGTTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-1451s1c1
Sequence:CCGGGACCGAAGAGTTTGTAGAGAACTCGAGTTCTCTACAAACTCTTCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016169.2-1236s1c1
Sequence:CCGGCGGCAGCTTGAGAGCGTACATCTCGAGATGTACGCTCTCAAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016169.2-508s1c1
Sequence:CCGGCCTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015752
SUFU MISSION shRNA Bacterial Glycerol Stock
suppressor of fused homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-547s21c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-961s21c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1367s21c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1548s21c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015752.2-2145s1c1
Sequence:CCGGCCTGAACTTTATTGTCCTTTACTCGAGTAAAGGACAATAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1367s1c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-547s1c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1548s1c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-961s1c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015752
SUFU MISSION shRNA shRNA Plasmid DNA
suppressor of fused homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-547s21c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-961s21c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1367s21c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1548s21c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015752.2-2145s1c1
Sequence:CCGGCCTGAACTTTATTGTCCTTTACTCGAGTAAAGGACAATAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1367s1c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-547s1c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1548s1c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-961s1c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015752
SUFU MISSION shRNA Lentiviral Transduction Particles
suppressor of fused homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-547s21c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-961s21c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1367s21c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015752.2-1548s21c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015752.2-2145s1c1
Sequence:CCGGCCTGAACTTTATTGTCCTTTACTCGAGTAAAGGACAATAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1367s1c1
Sequence:CCGGGCACTTCACCTACAAGAGTATCTCGAGATACTCTTGTAGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-547s1c1
Sequence:CCGGCGTTTCGTCTGAAGAGAGAAACTCGAGTTTCTCTCTTCAGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-1548s1c1
Sequence:CCGGGAGGAATTTAAACTTCCCAAACTCGAGTTTGGGAAGTTTAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015752.2-961s1c1
Sequence:CCGGGCATTGAGACAGACGGTTCTACTCGAGTAGAACCGTCTGTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks