EMAIL THIS PAGE TO A FRIEND

SUGP1

SURP and G patch domain containing 1

Synonyms: F23858 RBP SF4
Gene ID:
Human(57794) Summary: SF4 is a member of the SURP family of splicing factors.[supplied by OMIM, Sep 2003]
Mouse(70616) SURP and G patch domain containing 1
Rat(290666) SURP and G patch domain containing 1
Zebrafish(100073344) SURP and G patch domain containing 1
chicken(428349) SURP and G patch domain containing 1
domestic cat(101099188) SURP and G patch domain containing 1
dog(476661) SURP and G patch domain containing 1
naked mole-rat(101715948) SURP and G patch domain containing 1
domestic guinea pig(100718291) SURP and G patch domain containing 1
cow(533971) SURP and G patch domain containing 1
sheep(101105072) SURP and G patch domain containing 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S2070 Anti-SF4 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
AV40961 Anti-SF4 antibody produced in rabbit affinity isolated antibody , human, canine, bovine, zebrafish, mouse, guinea pig, rat, horse
western blot pricing
SAB2102123 Anti-SF4 antibody produced in rabbit affinity isolated antibody horse, canine, rat, mouse, bovine, rabbit, human, guinea pig
western blot pricing
HPA004890 Anti-SUGP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106535 Anti-SUGP1 antibody produced in rabbit affinity isolated antibody human, rabbit, horse, mouse, guinea pig, sheep
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172231 Rosetta Predictions human pricing
NM_001011920 Rosetta Predictions rat pricing
XM_573885 Rosetta Predictions rat pricing
NM_027481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056131 predicted 1851
2 SASI_Hs01_00056132 predicted 683
3 SASI_Hs01_00056133 predicted 647
4 SASI_Hs01_00056134 predicted 624
5 SASI_Hs01_00056135 predicted 887
6 SASI_Hs01_00056136 predicted 901
7 SASI_Hs01_00056137 predicted 673
8 SASI_Hs01_00056138 predicted 913
9 SASI_Hs02_00367940 predicted 619
10 SASI_Hs02_00367941 predicted 644
11 SASI_Hs01_00056130 predicted 1766
12 SASI_Hs01_00056139 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072846 predicted 865
2 SASI_Rn01_00072847 predicted 1657
3 SASI_Rn01_00072848 predicted 1766
4 SASI_Rn01_00072849 predicted 636
5 SASI_Rn01_00072850 predicted 1436
6 SASI_Rn01_00072852 predicted 1777
7 SASI_Rn01_00072853 predicted 909
8 SASI_Rn01_00072854 predicted 626
9 SASI_Rn01_00072855 predicted 1830
10 SASI_Rn02_00199919 predicted 1506
11 SASI_Rn01_00072851 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144436 predicted 1375
2 SASI_Rn01_00144437 predicted 1316
3 SASI_Rn01_00144438 predicted 1202
4 SASI_Rn01_00144439 predicted 1388
5 SASI_Rn01_00144440 predicted 1379
6 SASI_Rn01_00144441 predicted 1211
7 SASI_Rn01_00144442 predicted 1312
8 SASI_Rn01_00144443 predicted 1250
9 SASI_Rn01_00144444 predicted 1320
10 SASI_Rn01_00144445 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197419 predicted 1088
2 SASI_Mm01_00197413 predicted 1981
3 SASI_Mm01_00197420 predicted 1435
4 SASI_Mm01_00197415 predicted 867
5 SASI_Mm01_00197416 predicted 1881
6 SASI_Mm01_00197421 predicted 430
7 SASI_Mm01_00197417 predicted 1993
8 SASI_Mm01_00197422 predicted 1129
9 SASI_Mm02_00332294 predicted 850
10 SASI_Mm02_00332295 predicted 367
11 SASI_Mm01_00197414 predicted 2002
12 SASI_Mm01_00197418 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021164
SUGP1 MISSION shRNA Bacterial Glycerol Stock
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-649s1c1
Sequence:CCGGCCCTCTGTCGTTGTGGTCCATCTCGAGATGGACCACAACGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-123s1c1
Sequence:CCGGCAGAAGAAACGGGAAATTGAACTCGAGTTCAATTTCCCGTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-240s1c1
Sequence:CCGGTCCAACAAGTTTGCCAACGATCTCGAGATCGTTGGCAAACTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-120s1c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021164.2-1085s1c1
Sequence:CCGGGCTTTCTGTATGAGCCCAATACTCGAGTATTGGGCTCATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021164
SUGP1 MISSION shRNA shRNA Plasmid DNA
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-649s1c1
Sequence:CCGGCCCTCTGTCGTTGTGGTCCATCTCGAGATGGACCACAACGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-123s1c1
Sequence:CCGGCAGAAGAAACGGGAAATTGAACTCGAGTTCAATTTCCCGTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-240s1c1
Sequence:CCGGTCCAACAAGTTTGCCAACGATCTCGAGATCGTTGGCAAACTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-120s1c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021164.2-1085s1c1
Sequence:CCGGGCTTTCTGTATGAGCCCAATACTCGAGTATTGGGCTCATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021164
SUGP1 MISSION shRNA Lentiviral Transduction Particles
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-649s1c1
Sequence:CCGGCCCTCTGTCGTTGTGGTCCATCTCGAGATGGACCACAACGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-123s1c1
Sequence:CCGGCAGAAGAAACGGGAAATTGAACTCGAGTTCAATTTCCCGTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-240s1c1
Sequence:CCGGTCCAACAAGTTTGCCAACGATCTCGAGATCGTTGGCAAACTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021164.2-120s1c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021164.2-1085s1c1
Sequence:CCGGGCTTTCTGTATGAGCCCAATACTCGAGTATTGGGCTCATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027481
VALIDATED
SUGP1 MISSION shRNA Bacterial Glycerol Stock
SURP and G patch domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027481.1-2169s1c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-646s1c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-1584s1c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-297s1c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027481.1-302s1c1
Sequence:CCGGCCAAGTCTGGAAAGATGAATACTCGAGTATTCATCTTTCCAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-297s21c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-1584s21c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-646s21c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027481.2-2169s21c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027481
VALIDATED
SUGP1 MISSION shRNA shRNA Plasmid DNA
SURP and G patch domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027481.1-2169s1c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-646s1c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-1584s1c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-297s1c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027481.1-302s1c1
Sequence:CCGGCCAAGTCTGGAAAGATGAATACTCGAGTATTCATCTTTCCAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-297s21c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-1584s21c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-646s21c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027481.2-2169s21c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027481
VALIDATED
SUGP1 MISSION shRNA Lentiviral Transduction Particles
SURP and G patch domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027481.1-2169s1c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-646s1c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-1584s1c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027481.1-297s1c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027481.1-302s1c1
Sequence:CCGGCCAAGTCTGGAAAGATGAATACTCGAGTATTCATCTTTCCAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-297s21c1
Sequence:CCGGACAACCCAAGTCTGGAAAGATCTCGAGATCTTTCCAGACTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-1584s21c1
Sequence:CCGGGCAGATGTATGACATGATTATCTCGAGATAATCATGTCATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027481.2-646s21c1
Sequence:CCGGCCTGTGAAGAACTACTCACATCTCGAGATGTGAGTAGTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027481.2-2169s21c1
Sequence:CCGGATTCTGGAAACACAAAGTCTACTCGAGTAGACTTTGTGTTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172231
VALIDATED
SUGP1 MISSION shRNA Bacterial Glycerol Stock
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-565s21c1
Sequence:GTACCGGCTCGGAAAGTGATAGAGAAATCTCGAGATTTCTCTATCACTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-648s21c1
Sequence:CCGGGATAACCCAGCATTTGCATTTCTCGAGAAATGCAAATGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-221s21c1
Sequence:CCGGACACAACTCTTCCTGCATTTCCTCGAGGAAATGCAGGAAGAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-198s21c1
Sequence:CCGGCATCCTGGCGAAATCACAAATCTCGAGATTTGTGATTTCGCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-120s21c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172231
VALIDATED
SUGP1 MISSION shRNA shRNA Plasmid DNA
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-565s21c1
Sequence:GTACCGGCTCGGAAAGTGATAGAGAAATCTCGAGATTTCTCTATCACTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-648s21c1
Sequence:CCGGGATAACCCAGCATTTGCATTTCTCGAGAAATGCAAATGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-221s21c1
Sequence:CCGGACACAACTCTTCCTGCATTTCCTCGAGGAAATGCAGGAAGAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-198s21c1
Sequence:CCGGCATCCTGGCGAAATCACAAATCTCGAGATTTGTGATTTCGCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-120s21c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172231
VALIDATED
SUGP1 MISSION shRNA Lentiviral Transduction Particles
SURP and G patch domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-565s21c1
Sequence:GTACCGGCTCGGAAAGTGATAGAGAAATCTCGAGATTTCTCTATCACTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-648s21c1
Sequence:CCGGGATAACCCAGCATTTGCATTTCTCGAGAAATGCAAATGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-221s21c1
Sequence:CCGGACACAACTCTTCCTGCATTTCCTCGAGGAAATGCAGGAAGAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-198s21c1
Sequence:CCGGCATCCTGGCGAAATCACAAATCTCGAGATTTGTGATTTCGCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_172231.2-120s21c1
Sequence:CCGGGCTCAGAAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks