EMAIL THIS PAGE TO A FRIEND

SUGP2

SURP and G patch domain containing 2

Synonyms: SFRS14
UniProtKB ID: Q8IX01, C9JI71, O15071, O60369, Q5JPH7, Q8WUF7
Gene ID:
Human(10147) Summary: This gene encodes a member of the arginine/serine-rich family of splicing factors. The encoded protein functions in mRNA processing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Mouse(234373) SURP and G patch domain containing 2
Rat(361126) SURP and G patch domain containing 2
cow(516567) SURP and G patch domain containing 2
sheep(101106843) SURP and G patch domain containing 2
domestic guinea pig(100714923) SURP and G patch domain containing 2
naked mole-rat(101708674) SURP and G patch domain containing 2
chicken(420113) SURP and G patch domain containing 2
Horse(100071102) SURP and G patch domain containing 2
domestic cat(101090422) SURP and G patch domain containing 2
dog(487882) SURP and G patch domain containing 2
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017392 Rosetta Predictions human pricing
NM_014884 Rosetta Predictions human pricing
NM_001108397 Rosetta Predictions rat pricing
NM_172755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164036 predicted 1080
2 SASI_Hs01_00164037 predicted 3014
3 SASI_Hs01_00164038 predicted 1419
4 SASI_Hs01_00164039 predicted 1422
5 SASI_Hs01_00164040 predicted 251
6 SASI_Hs01_00164041 predicted 378
7 SASI_Hs01_00164042 predicted 1626
8 SASI_Hs01_00164043 predicted 586
9 SASI_Hs01_00164044 predicted 2471
10 SASI_Hs01_00164045 predicted 3100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063816 predicted 1133
2 SASI_Hs01_00063817 predicted 3065
3 SASI_Hs01_00063818 predicted 1476
4 SASI_Hs01_00063819 predicted 1491
5 SASI_Hs01_00063820 predicted 310
6 SASI_Hs01_00063821 predicted 437
7 SASI_Hs01_00063822 predicted 1691
8 SASI_Hs01_00063823 predicted 648
9 SASI_Hs01_00063824 predicted 2531
10 SASI_Hs01_00063825 predicted 3160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238259 predicted 3570
2 SASI_Rn02_00238260 predicted 3317
3 SASI_Rn02_00238261 predicted 1829
4 SASI_Rn02_00238262 predicted 2061
5 SASI_Rn02_00238263 predicted 3620
6 SASI_Rn02_00238264 predicted 3611
7 SASI_Rn02_00238265 predicted 1751
8 SASI_Rn02_00238266 predicted 1539
9 SASI_Rn02_00238267 predicted 1473
10 SASI_Rn02_00238268 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067264 predicted 3577
2 SASI_Mm01_00067265 predicted 3330
3 SASI_Mm01_00067266 predicted 1957
4 SASI_Mm01_00067267 predicted 2742
5 SASI_Mm01_00067268 predicted 1514
6 SASI_Mm01_00067270 predicted 1200
7 SASI_Mm01_00067272 predicted 1554
8 SASI_Mm01_00067273 predicted 1377
9 SASI_Mm02_00344609 predicted 3622
10 SASI_Mm02_00344610 predicted 2227
11 SASI_Mm01_00067269 predicted 739
12 SASI_Mm01_00067271 predicted 2249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014884
VALIDATED
SUGP2 MISSION shRNA Bacterial Glycerol Stock
SURP and G patch domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-369s21c1
Sequence:CCGGGGCCTGAGAAGTGACGTATTTCTCGAGAAATACGTCACTTCTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-497s21c1
Sequence:CCGGGGTCATTGGCCACCGGAAATTCTCGAGAATTTCCGGTGGCCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014884.2-3448s21c1
Sequence:CCGGTTACTGTCTCTGGCTTGTTTCCTCGAGGAAACAAGCCAGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-898s21c1
Sequence:CCGGTACCCACCGTGAATCGTATTACTCGAGTAATACGATTCACGGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-687s21c1
Sequence:CCGGGAGAAGGAGAGTCGGGATTATCTCGAGATAATCCCGACTCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-651s1c1
Sequence:CCGGCTTTGGATCTTCCAGGCTGATCTCGAGATCAGCCTGGAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-3003s1c1
Sequence:CCGGGTCATTGAAGGTTGGCATGATCTCGAGATCATGCCAACCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-1449s1c1
Sequence:CCGGGAGTGTCACACCTTTGCTTATCTCGAGATAAGCAAAGGTGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-1813s1c1
Sequence:CCGGCCTCCTACGAAACCTGAAATTCTCGAGAATTTCAGGTTTCGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-906s1c1
Sequence:CCGGCGTGAATCGTATTACTCCCAACTCGAGTTGGGAGTAATACGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-3000s1c1
Sequence:CCGGCAAGTCATTGAAGGTTGGCATCTCGAGATGCCAACCTTCAATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-401s1c1
Sequence:CCGGCCTTCAGATCAAGCAACCCTTCTCGAGAAGGGTTGCTTGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014884
VALIDATED
SUGP2 MISSION shRNA shRNA Plasmid DNA
SURP and G patch domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-369s21c1
Sequence:CCGGGGCCTGAGAAGTGACGTATTTCTCGAGAAATACGTCACTTCTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-497s21c1
Sequence:CCGGGGTCATTGGCCACCGGAAATTCTCGAGAATTTCCGGTGGCCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014884.2-3448s21c1
Sequence:CCGGTTACTGTCTCTGGCTTGTTTCCTCGAGGAAACAAGCCAGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-898s21c1
Sequence:CCGGTACCCACCGTGAATCGTATTACTCGAGTAATACGATTCACGGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-687s21c1
Sequence:CCGGGAGAAGGAGAGTCGGGATTATCTCGAGATAATCCCGACTCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-651s1c1
Sequence:CCGGCTTTGGATCTTCCAGGCTGATCTCGAGATCAGCCTGGAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-3003s1c1
Sequence:CCGGGTCATTGAAGGTTGGCATGATCTCGAGATCATGCCAACCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-1449s1c1
Sequence:CCGGGAGTGTCACACCTTTGCTTATCTCGAGATAAGCAAAGGTGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-1813s1c1
Sequence:CCGGCCTCCTACGAAACCTGAAATTCTCGAGAATTTCAGGTTTCGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-906s1c1
Sequence:CCGGCGTGAATCGTATTACTCCCAACTCGAGTTGGGAGTAATACGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-3000s1c1
Sequence:CCGGCAAGTCATTGAAGGTTGGCATCTCGAGATGCCAACCTTCAATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-401s1c1
Sequence:CCGGCCTTCAGATCAAGCAACCCTTCTCGAGAAGGGTTGCTTGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014884
VALIDATED
SUGP2 MISSION shRNA Lentiviral Transduction Particles
SURP and G patch domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-369s21c1
Sequence:CCGGGGCCTGAGAAGTGACGTATTTCTCGAGAAATACGTCACTTCTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-497s21c1
Sequence:CCGGGGTCATTGGCCACCGGAAATTCTCGAGAATTTCCGGTGGCCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014884.2-3448s21c1
Sequence:CCGGTTACTGTCTCTGGCTTGTTTCCTCGAGGAAACAAGCCAGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014884.2-898s21c1
Sequence:CCGGTACCCACCGTGAATCGTATTACTCGAGTAATACGATTCACGGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014884.2-687s21c1
Sequence:CCGGGAGAAGGAGAGTCGGGATTATCTCGAGATAATCCCGACTCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-651s1c1
Sequence:CCGGCTTTGGATCTTCCAGGCTGATCTCGAGATCAGCCTGGAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-3003s1c1
Sequence:CCGGGTCATTGAAGGTTGGCATGATCTCGAGATCATGCCAACCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014884.1-1449s1c1
Sequence:CCGGGAGTGTCACACCTTTGCTTATCTCGAGATAAGCAAAGGTGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-1813s1c1
Sequence:CCGGCCTCCTACGAAACCTGAAATTCTCGAGAATTTCAGGTTTCGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-906s1c1
Sequence:CCGGCGTGAATCGTATTACTCCCAACTCGAGTTGGGAGTAATACGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-3000s1c1
Sequence:CCGGCAAGTCATTGAAGGTTGGCATCTCGAGATGCCAACCTTCAATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014884.1-401s1c1
Sequence:CCGGCCTTCAGATCAAGCAACCCTTCTCGAGAAGGGTTGCTTGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172755
VALIDATED
SUGP2 MISSION shRNA Bacterial Glycerol Stock
SURP and G patch domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-2256s1c1
Sequence:CCGGCCTGGAGTATAAGTACTACAACTCGAGTTGTAGTACTTATACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-577s1c1
Sequence:CCGGGCAGATGTCTATGAGGACATTCTCGAGAATGTCCTCATAGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172755.2-3741s1c1
Sequence:CCGGGTTGATTCTGTACCTGGTAAACTCGAGTTTACCAGGTACAGAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-2255s1c1
Sequence:CCGGGCCTGGAGTATAAGTACTACACTCGAGTGTAGTACTTATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-1177s1c1
Sequence:CCGGGCCAGTCGTATTACTTCCAAACTCGAGTTTGGAAGTAATACGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172755
VALIDATED
SUGP2 MISSION shRNA shRNA Plasmid DNA
SURP and G patch domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-2256s1c1
Sequence:CCGGCCTGGAGTATAAGTACTACAACTCGAGTTGTAGTACTTATACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-577s1c1
Sequence:CCGGGCAGATGTCTATGAGGACATTCTCGAGAATGTCCTCATAGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172755.2-3741s1c1
Sequence:CCGGGTTGATTCTGTACCTGGTAAACTCGAGTTTACCAGGTACAGAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-2255s1c1
Sequence:CCGGGCCTGGAGTATAAGTACTACACTCGAGTGTAGTACTTATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-1177s1c1
Sequence:CCGGGCCAGTCGTATTACTTCCAAACTCGAGTTTGGAAGTAATACGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172755
VALIDATED
SUGP2 MISSION shRNA Lentiviral Transduction Particles
SURP and G patch domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-2256s1c1
Sequence:CCGGCCTGGAGTATAAGTACTACAACTCGAGTTGTAGTACTTATACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-577s1c1
Sequence:CCGGGCAGATGTCTATGAGGACATTCTCGAGAATGTCCTCATAGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172755.2-3741s1c1
Sequence:CCGGGTTGATTCTGTACCTGGTAAACTCGAGTTTACCAGGTACAGAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172755.2-2255s1c1
Sequence:CCGGGCCTGGAGTATAAGTACTACACTCGAGTGTAGTACTTATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172755.2-1177s1c1
Sequence:CCGGGCCAGTCGTATTACTTCCAAACTCGAGTTTGGAAGTAATACGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks