EMAIL THIS PAGE TO A FRIEND

SUGT1

SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)

Synonyms: SGT1
UniProtKB ID: Q9Y2Z0, A2A303, Q5JAK5, Q5TAM6, Q6VXY6
Gene ID:
Human(10910) Summary: This gene is homologous to the yeast gene SGT1, which encodes a protein involved in kinetochore function and required for the G1/S and G2/M transitions. Complementation studies suggest that the human protein has similar functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(67955) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Rat(290408) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
chicken(418827) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
domestic cat(101088808) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
dog(609605) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
naked mole-rat(101703454) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
domestic guinea pig(100734850) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
cow(515509) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
sheep(101122608) SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006704 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069071 MISSION® esiRNA esiRNA targeting mouse Sugt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006704 Rosetta Predictions human pricing
NM_001013051 Rosetta Predictions rat pricing
NM_026474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167088 predicted 1091
2 SASI_Hs01_00167090 predicted 568
3 SASI_Hs02_00342129 predicted 1093
4 SASI_Hs01_00167092 predicted 499
5 SASI_Hs01_00167093 predicted 1100
6 SASI_Hs02_00342130 predicted 888
7 SASI_Hs01_00167094 predicted 261
8 SASI_Hs01_00167095 predicted 1152
9 SASI_Hs01_00167096 predicted 256
10 SASI_Hs01_00167097 predicted 773
11 SASI_Hs01_00167089 predicted 422
12 SASI_Hs01_00167091 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200657 predicted 231
2 SASI_Rn02_00200658 predicted 877
3 SASI_Rn02_00200659 predicted 227
4 SASI_Rn02_00200660 predicted 904
5 SASI_Rn02_00200661 predicted 421
6 SASI_Rn02_00200662 predicted 513
7 SASI_Rn02_00200663 predicted 757
8 SASI_Rn02_00200664 predicted 500
9 SASI_Rn02_00200665 predicted 509
10 SASI_Rn02_00200666 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102327 predicted 432
2 SASI_Mm01_00102328 predicted 607
3 SASI_Mm01_00102329 predicted 589
4 SASI_Mm01_00102330 predicted 585
5 SASI_Mm01_00102331 predicted 988
6 SASI_Mm01_00102332 predicted 848
7 SASI_Mm01_00102333 predicted 906
8 SASI_Mm01_00102334 predicted 246
9 SASI_Mm01_00102335 predicted 968
10 SASI_Mm01_00102336 predicted 1144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026474
VALIDATED
SUGT1 MISSION shRNA Bacterial Glycerol Stock
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026474.2-336s1c1
Sequence:CCGGGCCGATGTAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026474.2-505s1c1
Sequence:CCGGGCCAAGAAATTCAGAATGGATCTCGAGATCCATTCTGAATTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1588s1c1
Sequence:CCGGGCTTTATTTACCTTCCTCTTACTCGAGTAAGAGGAAGGTAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1517s1c1
Sequence:CCGGGCTTCAGTGTTGTGTTTACTTCTCGAGAAGTAAACACAACACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026474.2-969s1c1
Sequence:CCGGGACGCAGCTTTAAACAAGTTACTCGAGTAACTTGTTTAAAGCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1194s1c1
Sequence:CCGGGCCCATTGTGTGCTTTATCATCTCGAGATGATAAAGCACACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-719s21c1
Sequence:CCGGGGCTGCTCCACCCTATAATACCTCGAGGTATTATAGGGTGGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1307s21c1
Sequence:CCGGGACAATCACATCTTATCATTTCTCGAGAAATGATAAGATGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-969s21c1
Sequence:CCGGCGCAGCTTTAAACAAGTTATTCTCGAGAATAACTTGTTTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-1131s21c1
Sequence:CCGGGGAATGGAAACAGTACTAAATCTCGAGATTTAGTACTGTTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-594s21c1
Sequence:CCGGTCACGTAATCATCACCCTTATCTCGAGATAAGGGTGATGATTACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1386s21c1
Sequence:CCGGAGATCCGCTCTGTCTAGTTATCTCGAGATAACTAGACAGAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026474.5-260s21c1
Sequence:CCGGATCCGGATGACGCACAGTATTCTCGAGAATACTGTGCGTCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026474
VALIDATED
SUGT1 MISSION shRNA shRNA Plasmid DNA
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026474.2-336s1c1
Sequence:CCGGGCCGATGTAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026474.2-505s1c1
Sequence:CCGGGCCAAGAAATTCAGAATGGATCTCGAGATCCATTCTGAATTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1588s1c1
Sequence:CCGGGCTTTATTTACCTTCCTCTTACTCGAGTAAGAGGAAGGTAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1517s1c1
Sequence:CCGGGCTTCAGTGTTGTGTTTACTTCTCGAGAAGTAAACACAACACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026474.2-969s1c1
Sequence:CCGGGACGCAGCTTTAAACAAGTTACTCGAGTAACTTGTTTAAAGCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1194s1c1
Sequence:CCGGGCCCATTGTGTGCTTTATCATCTCGAGATGATAAAGCACACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-719s21c1
Sequence:CCGGGGCTGCTCCACCCTATAATACCTCGAGGTATTATAGGGTGGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1307s21c1
Sequence:CCGGGACAATCACATCTTATCATTTCTCGAGAAATGATAAGATGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-969s21c1
Sequence:CCGGCGCAGCTTTAAACAAGTTATTCTCGAGAATAACTTGTTTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-1131s21c1
Sequence:CCGGGGAATGGAAACAGTACTAAATCTCGAGATTTAGTACTGTTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-594s21c1
Sequence:CCGGTCACGTAATCATCACCCTTATCTCGAGATAAGGGTGATGATTACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1386s21c1
Sequence:CCGGAGATCCGCTCTGTCTAGTTATCTCGAGATAACTAGACAGAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026474.5-260s21c1
Sequence:CCGGATCCGGATGACGCACAGTATTCTCGAGAATACTGTGCGTCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026474
VALIDATED
SUGT1 MISSION shRNA Lentiviral Transduction Particles
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026474.2-336s1c1
Sequence:CCGGGCCGATGTAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026474.2-505s1c1
Sequence:CCGGGCCAAGAAATTCAGAATGGATCTCGAGATCCATTCTGAATTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1588s1c1
Sequence:CCGGGCTTTATTTACCTTCCTCTTACTCGAGTAAGAGGAAGGTAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1517s1c1
Sequence:CCGGGCTTCAGTGTTGTGTTTACTTCTCGAGAAGTAAACACAACACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026474.2-969s1c1
Sequence:CCGGGACGCAGCTTTAAACAAGTTACTCGAGTAACTTGTTTAAAGCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026474.2-1194s1c1
Sequence:CCGGGCCCATTGTGTGCTTTATCATCTCGAGATGATAAAGCACACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-719s21c1
Sequence:CCGGGGCTGCTCCACCCTATAATACCTCGAGGTATTATAGGGTGGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1307s21c1
Sequence:CCGGGACAATCACATCTTATCATTTCTCGAGAAATGATAAGATGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-969s21c1
Sequence:CCGGCGCAGCTTTAAACAAGTTATTCTCGAGAATAACTTGTTTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-1131s21c1
Sequence:CCGGGGAATGGAAACAGTACTAAATCTCGAGATTTAGTACTGTTTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026474.5-594s21c1
Sequence:CCGGTCACGTAATCATCACCCTTATCTCGAGATAAGGGTGATGATTACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026474.5-1386s21c1
Sequence:CCGGAGATCCGCTCTGTCTAGTTATCTCGAGATAACTAGACAGAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026474.5-260s21c1
Sequence:CCGGATCCGGATGACGCACAGTATTCTCGAGAATACTGTGCGTCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006704
VALIDATED
SUGT1 MISSION shRNA Bacterial Glycerol Stock
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006704.2-1070s1c1
Sequence:CCGGGCTCTCATCGTATTGTGTATACTCGAGTATACACAATACGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-1028s1c1
Sequence:CCGGCCTGATGATATGGAATGGAAACTCGAGTTTCCATTCCATATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-770s1c1
Sequence:CCGGGCAGATGTAAAGAACCTATATCTCGAGATATAGGTTCTTTACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-251s1c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-657s1c1
Sequence:CCGGGCACGTTTAAAGTACTTTCAACTCGAGTTGAAAGTACTTTAAACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-817s21c1
Sequence:CCGGCCAGAACAGAGCACGTTTAAACTCGAGTTTAAACGTGCTCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-421s21c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006704.3-1251s21c1
Sequence:CCGGATTGTGTATATTCACCTAATGCTCGAGCATTAGGTGAATATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-665s21c1
Sequence:CCGGCAGAATCTCAAGTAGTCATTACTCGAGTAATGACTACTTGAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-795s21c1
Sequence:CCGGGGAACTTCTTCATCCTATAATCTCGAGATTATAGGATGAAGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006704
VALIDATED
SUGT1 MISSION shRNA shRNA Plasmid DNA
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006704.2-1070s1c1
Sequence:CCGGGCTCTCATCGTATTGTGTATACTCGAGTATACACAATACGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-1028s1c1
Sequence:CCGGCCTGATGATATGGAATGGAAACTCGAGTTTCCATTCCATATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-770s1c1
Sequence:CCGGGCAGATGTAAAGAACCTATATCTCGAGATATAGGTTCTTTACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-251s1c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-657s1c1
Sequence:CCGGGCACGTTTAAAGTACTTTCAACTCGAGTTGAAAGTACTTTAAACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-817s21c1
Sequence:CCGGCCAGAACAGAGCACGTTTAAACTCGAGTTTAAACGTGCTCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-421s21c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006704.3-1251s21c1
Sequence:CCGGATTGTGTATATTCACCTAATGCTCGAGCATTAGGTGAATATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-665s21c1
Sequence:CCGGCAGAATCTCAAGTAGTCATTACTCGAGTAATGACTACTTGAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-795s21c1
Sequence:CCGGGGAACTTCTTCATCCTATAATCTCGAGATTATAGGATGAAGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006704
VALIDATED
SUGT1 MISSION shRNA Lentiviral Transduction Particles
SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006704.2-1070s1c1
Sequence:CCGGGCTCTCATCGTATTGTGTATACTCGAGTATACACAATACGATGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-1028s1c1
Sequence:CCGGCCTGATGATATGGAATGGAAACTCGAGTTTCCATTCCATATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-770s1c1
Sequence:CCGGGCAGATGTAAAGAACCTATATCTCGAGATATAGGTTCTTTACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006704.2-251s1c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006704.2-657s1c1
Sequence:CCGGGCACGTTTAAAGTACTTTCAACTCGAGTTGAAAGTACTTTAAACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-817s21c1
Sequence:CCGGCCAGAACAGAGCACGTTTAAACTCGAGTTTAAACGTGCTCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-421s21c1
Sequence:CCGGGCTGATGCAAAGAAGTCTCTACTCGAGTAGAGACTTCTTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006704.3-1251s21c1
Sequence:CCGGATTGTGTATATTCACCTAATGCTCGAGCATTAGGTGAATATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-665s21c1
Sequence:CCGGCAGAATCTCAAGTAGTCATTACTCGAGTAATGACTACTTGAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006704.3-795s21c1
Sequence:CCGGGGAACTTCTTCATCCTATAATCTCGAGATTATAGGATGAAGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks