EMAIL THIS PAGE TO A FRIEND

SULF1

sulfatase 1

Synonyms: HSULF-1 SULF-1
UniProtKB ID: Q8IWU6, Q86YV8, Q8NCA2, Q9UPS5
Gene ID:
Human(23213) Summary: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF1, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]
Mouse(240725) sulfatase 1
Rat(171396) sulfatase 1
fruit fly(53437) Sulfated
Horse(100051725) sulfatase 1
dog(486986) sulfatase 1
chicken(426312) sulfatase 1
Zebrafish(337298) sulfatase 1
cow(535166) sulfatase 1
sheep(101103485) sulfatase 1
Gene Class: Apoptosis
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128204 Rosetta Predictions human pricing
NM_001128205 Rosetta Predictions human pricing
NM_001128206 Rosetta Predictions human pricing
NM_015170 Rosetta Predictions human pricing
NM_134378 Rosetta Predictions rat pricing
NM_172294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330796 predicted 1124
2 SASI_Hs02_00330797 predicted 1119
3 SASI_Hs02_00330798 predicted 3137
4 SASI_Hs02_00330799 predicted 2053
5 SASI_Hs02_00330800 predicted 1935
6 SASI_Hs02_00330801 predicted 2973
7 SASI_Hs02_00330802 predicted 1959
8 SASI_Hs02_00330803 predicted 1371
9 SASI_Hs02_00330804 predicted 3185
10 SASI_Hs02_00330805 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330806 predicted 1294
2 SASI_Hs02_00330807 predicted 1285
3 SASI_Hs02_00330808 predicted 3313
4 SASI_Hs02_00330809 predicted 2217
5 SASI_Hs02_00330810 predicted 2100
6 SASI_Hs02_00330811 predicted 3140
7 SASI_Hs02_00330812 predicted 2126
8 SASI_Hs02_00330813 predicted 1538
9 SASI_Hs02_00330814 predicted 3358
10 SASI_Hs02_00330815 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330816 predicted 1137
2 SASI_Hs02_00330817 predicted 1118
3 SASI_Hs02_00330818 predicted 3147
4 SASI_Hs02_00330819 predicted 2056
5 SASI_Hs02_00330820 predicted 1937
6 SASI_Hs02_00330821 predicted 2972
7 SASI_Hs02_00330822 predicted 1971
8 SASI_Hs02_00330823 predicted 1382
9 SASI_Hs02_00330824 predicted 3191
10 SASI_Hs02_00330825 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095554 predicted 1273
2 SASI_Hs01_00095555 predicted 1266
3 SASI_Hs02_00347171 predicted 3296
4 SASI_Hs01_00095556 predicted 2198
5 SASI_Hs01_00095557 predicted 2083
6 SASI_Hs01_00095559 predicted 3123
7 SASI_Hs01_00095561 predicted 2109
8 SASI_Hs01_00095562 predicted 1528
9 SASI_Hs01_00095563 predicted 3340
10 SASI_Hs02_00347172 predicted 1423
11 SASI_Hs01_00095558 predicted 2016
12 SASI_Hs01_00095560 predicted 2416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034243 predicted 1466
2 SASI_Rn02_00267943 predicted 1912
3 SASI_Rn01_00034244 predicted 1695
4 SASI_Rn01_00034245 predicted 538
5 SASI_Rn01_00034246 predicted 895
6 SASI_Rn01_00034247 predicted 979
7 SASI_Rn01_00034248 predicted 1455
8 SASI_Rn01_00034249 predicted 702
9 SASI_Rn01_00034250 predicted 2336
10 SASI_Rn01_00034251 predicted 449
11 SASI_Rn01_00034242 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044028 predicted 3162
2 SASI_Mm01_00044029 predicted 1519
3 SASI_Mm01_00044030 predicted 2246
4 SASI_Mm01_00044031 predicted 2874
5 SASI_Mm01_00044032 predicted 1099
6 SASI_Mm01_00044033 predicted 1961
7 SASI_Mm01_00044034 predicted 587
8 SASI_Mm01_00044035 predicted 1503
9 SASI_Mm01_00044036 predicted 1031
10 SASI_Mm01_00044037 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015170
SULF1 MISSION shRNA Bacterial Glycerol Stock
sulfatase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1660s21c1
Sequence:CCGGGCCGACCATGGTTACCATATTCTCGAGAATATGGTAACCATGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1185s21c1
Sequence:CCGGGCGAGAATGGCTTGGATTAATCTCGAGATTAATCCAAGCCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015170.2-3433s21c1
Sequence:CCGGTCTGGTGGACTGGACTAATTACTCGAGTAATTAGTCCAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2012s1c1
Sequence:CCGGCCCAAATATGAACGGGTCAAACTCGAGTTTGACCCGTTCATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2347s1c1
Sequence:CCGGCGTCGAATTTGAAGGTGAAATCTCGAGATTTCACCTTCAAATTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3044s1c1
Sequence:CCGGCGTACAGTTAATGAGACGCATCTCGAGATGCGTCTCATTAACTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3233s1c1
Sequence:CCGGCCAAGACCTAAGAATCTTGATCTCGAGATCAAGATTCTTAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-1432s1c1
Sequence:CCGGCCAACACATAACTCCTAGTTACTCGAGTAACTAGGAGTTATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015170
SULF1 MISSION shRNA shRNA Plasmid DNA
sulfatase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1660s21c1
Sequence:CCGGGCCGACCATGGTTACCATATTCTCGAGAATATGGTAACCATGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1185s21c1
Sequence:CCGGGCGAGAATGGCTTGGATTAATCTCGAGATTAATCCAAGCCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015170.2-3433s21c1
Sequence:CCGGTCTGGTGGACTGGACTAATTACTCGAGTAATTAGTCCAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2012s1c1
Sequence:CCGGCCCAAATATGAACGGGTCAAACTCGAGTTTGACCCGTTCATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2347s1c1
Sequence:CCGGCGTCGAATTTGAAGGTGAAATCTCGAGATTTCACCTTCAAATTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3044s1c1
Sequence:CCGGCGTACAGTTAATGAGACGCATCTCGAGATGCGTCTCATTAACTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3233s1c1
Sequence:CCGGCCAAGACCTAAGAATCTTGATCTCGAGATCAAGATTCTTAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-1432s1c1
Sequence:CCGGCCAACACATAACTCCTAGTTACTCGAGTAACTAGGAGTTATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015170
SULF1 MISSION shRNA Lentiviral Transduction Particles
sulfatase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1660s21c1
Sequence:CCGGGCCGACCATGGTTACCATATTCTCGAGAATATGGTAACCATGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015170.2-1185s21c1
Sequence:CCGGGCGAGAATGGCTTGGATTAATCTCGAGATTAATCCAAGCCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015170.2-3433s21c1
Sequence:CCGGTCTGGTGGACTGGACTAATTACTCGAGTAATTAGTCCAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2012s1c1
Sequence:CCGGCCCAAATATGAACGGGTCAAACTCGAGTTTGACCCGTTCATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-2347s1c1
Sequence:CCGGCGTCGAATTTGAAGGTGAAATCTCGAGATTTCACCTTCAAATTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3044s1c1
Sequence:CCGGCGTACAGTTAATGAGACGCATCTCGAGATGCGTCTCATTAACTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-3233s1c1
Sequence:CCGGCCAAGACCTAAGAATCTTGATCTCGAGATCAAGATTCTTAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015170.1-1432s1c1
Sequence:CCGGCCAACACATAACTCCTAGTTACTCGAGTAACTAGGAGTTATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172294
SULF1 MISSION shRNA Bacterial Glycerol Stock
sulfatase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3467s1c1
Sequence:CCGGCATTCCAGAAGTGAATCATTTCTCGAGAAATGATTCACTTCTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3871s1c1
Sequence:CCGGGATGTTGCCTAACATAATATTCTCGAGAATATTATGTTAGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1559s1c1
Sequence:CCGGGCTCCTACCATTCTGGATATTCTCGAGAATATCCAGAATGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-763s1c1
Sequence:CCGGCGTGCATAACCACAATGTCTACTCGAGTAGACATTGTGGTTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1209s1c1
Sequence:CCGGGCTATAACTATGCACCGAACACTCGAGTGTTCGGTGCATAGTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-2393s1c1
Sequence:CCGGGCCTACATTGATAAAGAGATTCTCGAGAATCTCTTTATCAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1771s1c1
Sequence:CCGGGCCCAAATATGAGAGGGTCAACTCGAGTTGACCCTCTCATATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172294.1-2503s1c1
Sequence:CCGGGAGCTATTACAACAAAGAGAACTCGAGTTCTCTTTGTTGTAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172294
SULF1 MISSION shRNA shRNA Plasmid DNA
sulfatase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3467s1c1
Sequence:CCGGCATTCCAGAAGTGAATCATTTCTCGAGAAATGATTCACTTCTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3871s1c1
Sequence:CCGGGATGTTGCCTAACATAATATTCTCGAGAATATTATGTTAGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1559s1c1
Sequence:CCGGGCTCCTACCATTCTGGATATTCTCGAGAATATCCAGAATGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-763s1c1
Sequence:CCGGCGTGCATAACCACAATGTCTACTCGAGTAGACATTGTGGTTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1209s1c1
Sequence:CCGGGCTATAACTATGCACCGAACACTCGAGTGTTCGGTGCATAGTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-2393s1c1
Sequence:CCGGGCCTACATTGATAAAGAGATTCTCGAGAATCTCTTTATCAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1771s1c1
Sequence:CCGGGCCCAAATATGAGAGGGTCAACTCGAGTTGACCCTCTCATATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172294.1-2503s1c1
Sequence:CCGGGAGCTATTACAACAAAGAGAACTCGAGTTCTCTTTGTTGTAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172294
SULF1 MISSION shRNA Lentiviral Transduction Particles
sulfatase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3467s1c1
Sequence:CCGGCATTCCAGAAGTGAATCATTTCTCGAGAAATGATTCACTTCTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172294.1-3871s1c1
Sequence:CCGGGATGTTGCCTAACATAATATTCTCGAGAATATTATGTTAGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1559s1c1
Sequence:CCGGGCTCCTACCATTCTGGATATTCTCGAGAATATCCAGAATGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-763s1c1
Sequence:CCGGCGTGCATAACCACAATGTCTACTCGAGTAGACATTGTGGTTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1209s1c1
Sequence:CCGGGCTATAACTATGCACCGAACACTCGAGTGTTCGGTGCATAGTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-2393s1c1
Sequence:CCGGGCCTACATTGATAAAGAGATTCTCGAGAATCTCTTTATCAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172294.1-1771s1c1
Sequence:CCGGGCCCAAATATGAGAGGGTCAACTCGAGTTGACCCTCTCATATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172294.1-2503s1c1
Sequence:CCGGGAGCTATTACAACAAAGAGAACTCGAGTTCTCTTTGTTGTAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks