EMAIL THIS PAGE TO A FRIEND

SULF2

sulfatase 2

Synonyms: HSULF-2
Gene ID:
Human(55959) Summary: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]
Mouse(72043) sulfatase 2
Rat(311642) sulfatase 2
cow(533264) sulfatase 2
sheep(101115391) sulfatase 2
Zebrafish(393910) sulfatase 2
chicken(419209) sulfatase 2
dog(477254) sulfatase 2
Horse(100056840) sulfatase 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108618 Anti-SULF2 IgG fraction of antiserum canine, pig, rabbit, rat, bovine, horse, human, mouse
immunohistochemistry, western blot pricing
SAB2501213 Anti-SULF2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AV49338 Anti-SULF2 antibody produced in rabbit IgG fraction of antiserum canine, bovine, horse, rat, mouse, rabbit, human
immunohistochemistry, western blot pricing
SAB1403305 Monoclonal Anti-SULF2 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018837 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018837 Rosetta Predictions human pricing
NM_198596 Rosetta Predictions human pricing
NM_001034927 Rosetta Predictions rat pricing
NM_028072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020422 predicted 2611
2 SASI_Hs01_00020423 predicted 916
3 SASI_Hs01_00020424 predicted 1054
4 SASI_Hs01_00020425 predicted 1148
5 SASI_Hs01_00020426 predicted 2291
6 SASI_Hs01_00020427 predicted 636
7 SASI_Hs01_00020428 predicted 1589
8 SASI_Hs02_00352287 predicted 745
9 SASI_Hs01_00020429 predicted 621
10 SASI_Hs01_00020430 predicted 2606
11 SASI_Hs01_00020421 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181162 predicted 2611
2 SASI_Hs01_00181163 predicted 911
3 SASI_Hs01_00181164 predicted 1054
4 SASI_Hs01_00181165 predicted 1155
5 SASI_Hs01_00181166 predicted 2290
6 SASI_Hs01_00181167 predicted 633
7 SASI_Hs01_00181168 predicted 1597
8 SASI_Hs02_00372241 predicted 738
9 SASI_Hs01_00181169 predicted 619
10 SASI_Hs01_00181170 predicted 2609
11 SASI_Hs01_00181161 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204087 predicted 3035
2 SASI_Rn02_00204088 predicted 1200
3 SASI_Rn02_00204089 predicted 1919
4 SASI_Rn02_00204090 predicted 1532
5 SASI_Rn02_00204091 predicted 1414
6 SASI_Rn02_00204092 predicted 1459
7 SASI_Rn02_00204093 predicted 1958
8 SASI_Rn02_00204094 predicted 1133
9 SASI_Rn02_00204095 predicted 867
10 SASI_Rn02_00204096 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027843 predicted 793
2 SASI_Mm01_00027844 predicted 2231
3 SASI_Mm01_00027845 predicted 2561
4 SASI_Mm01_00027846 predicted 1060
5 SASI_Mm01_00027847 predicted 971
6 SASI_Mm01_00027848 predicted 2833
7 SASI_Mm01_00027849 predicted 536
8 SASI_Mm01_00027850 predicted 1995
9 SASI_Mm01_00027851 predicted 2806
10 SASI_Mm01_00027852 predicted 2691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028072
SULF2 MISSION shRNA Bacterial Glycerol Stock
sulfatase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1779s1c1
Sequence:CCGGCGCCGTAAGCTCTTTAAGAAACTCGAGTTTCTTAAAGAGCTTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1353s1c1
Sequence:CCGGGACGGGAAGTCTATTCTCAAACTCGAGTTTGAGAATAGACTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-2028s1c1
Sequence:CCGGCGGTGCTACATCCTTGAGAATCTCGAGATTCTCAAGGATGTAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-2533s21c1
Sequence:CCGGTGGTGCTTGAGGACCATAAATCTCGAGATTTATGGTCCTCAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1655s21c1
Sequence:CCGGGGACGCTGAAGCTGCACAAATCTCGAGATTTGTGCAGCTTCAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028072.4-3964s21c1
Sequence:CCGGGTAGGGTAACCTGGTCAATATCTCGAGATATTGACCAGGTTACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-799s21c1
Sequence:CCGGTCAGACTACTCCACGGATTACCTCGAGGTAATCCGTGGAGTAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1886s21c1
Sequence:CCGGTCGAGGTGGACGGTGAGATATCTCGAGATATCTCACCGTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028072
SULF2 MISSION shRNA shRNA Plasmid DNA
sulfatase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1779s1c1
Sequence:CCGGCGCCGTAAGCTCTTTAAGAAACTCGAGTTTCTTAAAGAGCTTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1353s1c1
Sequence:CCGGGACGGGAAGTCTATTCTCAAACTCGAGTTTGAGAATAGACTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-2028s1c1
Sequence:CCGGCGGTGCTACATCCTTGAGAATCTCGAGATTCTCAAGGATGTAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-2533s21c1
Sequence:CCGGTGGTGCTTGAGGACCATAAATCTCGAGATTTATGGTCCTCAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1655s21c1
Sequence:CCGGGGACGCTGAAGCTGCACAAATCTCGAGATTTGTGCAGCTTCAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028072.4-3964s21c1
Sequence:CCGGGTAGGGTAACCTGGTCAATATCTCGAGATATTGACCAGGTTACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-799s21c1
Sequence:CCGGTCAGACTACTCCACGGATTACCTCGAGGTAATCCGTGGAGTAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1886s21c1
Sequence:CCGGTCGAGGTGGACGGTGAGATATCTCGAGATATCTCACCGTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028072
SULF2 MISSION shRNA Lentiviral Transduction Particles
sulfatase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1779s1c1
Sequence:CCGGCGCCGTAAGCTCTTTAAGAAACTCGAGTTTCTTAAAGAGCTTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-1353s1c1
Sequence:CCGGGACGGGAAGTCTATTCTCAAACTCGAGTTTGAGAATAGACTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028072.2-2028s1c1
Sequence:CCGGCGGTGCTACATCCTTGAGAATCTCGAGATTCTCAAGGATGTAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-2533s21c1
Sequence:CCGGTGGTGCTTGAGGACCATAAATCTCGAGATTTATGGTCCTCAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1655s21c1
Sequence:CCGGGGACGCTGAAGCTGCACAAATCTCGAGATTTGTGCAGCTTCAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028072.4-3964s21c1
Sequence:CCGGGTAGGGTAACCTGGTCAATATCTCGAGATATTGACCAGGTTACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-799s21c1
Sequence:CCGGTCAGACTACTCCACGGATTACCTCGAGGTAATCCGTGGAGTAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028072.4-1886s21c1
Sequence:CCGGTCGAGGTGGACGGTGAGATATCTCGAGATATCTCACCGTCCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018837
VALIDATED
SULF2 MISSION shRNA Bacterial Glycerol Stock
sulfatase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018837.2-3260s1c1
Sequence:CCGGCGAGAGAGATTTCCTTGGAAACTCGAGTTTCCAAGGAAATCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1308s1c1
Sequence:CCGGCCTGGTGAAAGGGAAATCCATCTCGAGATGGATTTCCCTTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-2778s1c1
Sequence:CCGGCAAGGGTTACAAGCAGTGTAACTCGAGTTACACTGCTTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-639s1c1
Sequence:CCGGCCACAACACCTACACCAACAACTCGAGTTGTTGGTGTAGGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1451s1c1
Sequence:CCGGGCCTGGACATACCTGCGGATACTCGAGTATCCGCAGGTATGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2616s21c1
Sequence:CCGGCATCAATGAGACTCACAATTTCTCGAGAAATTGTGAGTCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1400s21c1
Sequence:CCGGCCCACATCGTCCTCAACATTGCTCGAGCAATGTTGAGGACGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-3291s21c1
Sequence:CCGGGGGCGAAAGTCATTGGAATTTCTCGAGAAATTCCAATGACTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1464s21c1
Sequence:CCGGTGCGGATATGGACGGGAAATCCTCGAGGATTTCCCGTCCATATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2216s21c1
Sequence:CCGGTGCACATCGACCACGAGATTGCTCGAGCAATCTCGTGGTCGATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1251s21c1
Sequence:CCGGGGACAACACGTACATCGTATACTCGAGTATACGATGTACGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1202s21c1
Sequence:CCGGACGACTCCATGGAGACGATTTCTCGAGAAATCGTCTCCATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018837
VALIDATED
SULF2 MISSION shRNA shRNA Plasmid DNA
sulfatase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018837.2-3260s1c1
Sequence:CCGGCGAGAGAGATTTCCTTGGAAACTCGAGTTTCCAAGGAAATCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1308s1c1
Sequence:CCGGCCTGGTGAAAGGGAAATCCATCTCGAGATGGATTTCCCTTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-2778s1c1
Sequence:CCGGCAAGGGTTACAAGCAGTGTAACTCGAGTTACACTGCTTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-639s1c1
Sequence:CCGGCCACAACACCTACACCAACAACTCGAGTTGTTGGTGTAGGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1451s1c1
Sequence:CCGGGCCTGGACATACCTGCGGATACTCGAGTATCCGCAGGTATGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2616s21c1
Sequence:CCGGCATCAATGAGACTCACAATTTCTCGAGAAATTGTGAGTCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1400s21c1
Sequence:CCGGCCCACATCGTCCTCAACATTGCTCGAGCAATGTTGAGGACGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-3291s21c1
Sequence:CCGGGGGCGAAAGTCATTGGAATTTCTCGAGAAATTCCAATGACTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1464s21c1
Sequence:CCGGTGCGGATATGGACGGGAAATCCTCGAGGATTTCCCGTCCATATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2216s21c1
Sequence:CCGGTGCACATCGACCACGAGATTGCTCGAGCAATCTCGTGGTCGATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1251s21c1
Sequence:CCGGGGACAACACGTACATCGTATACTCGAGTATACGATGTACGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1202s21c1
Sequence:CCGGACGACTCCATGGAGACGATTTCTCGAGAAATCGTCTCCATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018837
VALIDATED
SULF2 MISSION shRNA Lentiviral Transduction Particles
sulfatase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018837.2-3260s1c1
Sequence:CCGGCGAGAGAGATTTCCTTGGAAACTCGAGTTTCCAAGGAAATCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1308s1c1
Sequence:CCGGCCTGGTGAAAGGGAAATCCATCTCGAGATGGATTTCCCTTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-2778s1c1
Sequence:CCGGCAAGGGTTACAAGCAGTGTAACTCGAGTTACACTGCTTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018837.2-639s1c1
Sequence:CCGGCCACAACACCTACACCAACAACTCGAGTTGTTGGTGTAGGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018837.2-1451s1c1
Sequence:CCGGGCCTGGACATACCTGCGGATACTCGAGTATCCGCAGGTATGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2616s21c1
Sequence:CCGGCATCAATGAGACTCACAATTTCTCGAGAAATTGTGAGTCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1400s21c1
Sequence:CCGGCCCACATCGTCCTCAACATTGCTCGAGCAATGTTGAGGACGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-3291s21c1
Sequence:CCGGGGGCGAAAGTCATTGGAATTTCTCGAGAAATTCCAATGACTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1464s21c1
Sequence:CCGGTGCGGATATGGACGGGAAATCCTCGAGGATTTCCCGTCCATATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-2216s21c1
Sequence:CCGGTGCACATCGACCACGAGATTGCTCGAGCAATCTCGTGGTCGATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1251s21c1
Sequence:CCGGGGACAACACGTACATCGTATACTCGAGTATACGATGTACGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018837.3-1202s21c1
Sequence:CCGGACGACTCCATGGAGACGATTTCTCGAGAAATCGTCTCCATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks