EMAIL THIS PAGE TO A FRIEND

SULT1A1

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1

Synonyms: HAST1/HAST2 P-PST PST ST1A1 ST1A3 STP STP1 TSPST1
UniProtKB ID: P50225, Q2NL71, Q86U58, Q92818, Q9BVU6, Q9UGG7
Gene ID:
Human(6817) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Multiple alternatively spliced variants that encode two isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(20887) sulfotransferase family 1A, phenol-preferring, member 1
Rat(83783) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
dog(403892) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
domestic cat(101088902) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
cow(282485) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
sheep(101114075) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
naked mole-rat(101697399) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107551 MISSION® esiRNA esiRNA human SULT1A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001055 Rosetta Predictions human pricing
NM_177529 Rosetta Predictions human pricing
NM_177530 Rosetta Predictions human pricing
NM_177534 Rosetta Predictions human pricing
NM_177536 Rosetta Predictions human pricing
NM_031834 Rosetta Predictions rat pricing
NM_133670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050772 predicted 765
2 SASI_Hs01_00050773 predicted 757
3 SASI_Hs01_00050774 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045589 predicted 794
2 SASI_Hs01_00045590 predicted 791
3 SASI_Hs01_00045591 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210863 predicted 922
2 SASI_Hs01_00210864 predicted 925
3 SASI_Hs01_00210865 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230218 predicted 1127
2 SASI_Hs01_00230219 predicted 1119
3 SASI_Hs01_00230220 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044170 predicted 763
2 SASI_Hs01_00044171 predicted 761
3 SASI_Hs01_00044172 predicted 421
4 SASI_Hs01_00044173 predicted 457
5 SASI_Hs01_00044174 predicted 422
6 SASI_Hs01_00044175 predicted 475
7 SASI_Hs01_00044176 predicted 586
8 SASI_Hs01_00044177 predicted 463
9 SASI_Hs01_00044178 predicted 395
10 SASI_Hs01_00044179 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040152 predicted 931
2 SASI_Rn02_00265314 predicted 472
3 SASI_Rn01_00040155 predicted 673
4 SASI_Rn01_00040156 predicted 428
5 SASI_Rn02_00265315 predicted 809
6 SASI_Rn01_00040157 predicted 246
7 SASI_Rn01_00040158 predicted 223
8 SASI_Rn01_00040159 predicted 436
9 SASI_Rn02_00265316 predicted 703
10 SASI_Rn01_00040160 predicted 924
11 SASI_Rn01_00040153 predicted 925
12 SASI_Rn01_00040154 predicted 999
13 SASI_Rn01_00040161 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075753 predicted 229
2 SASI_Mm01_00075754 predicted 625
3 SASI_Mm01_00075755 predicted 270
4 SASI_Mm01_00075756 predicted 425
5 SASI_Mm01_00075757 predicted 651
6 SASI_Mm01_00075758 predicted 374
7 SASI_Mm01_00075759 predicted 343
8 SASI_Mm01_00075760 predicted 706
9 SASI_Mm01_00075761 predicted 365
10 SASI_Mm01_00075762 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001055
SULT1A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1159s21c1
Sequence:CCGGAGACCAACCTGGGCAACATAGCTCGAGCTATGTTGCCCAGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1123s21c1
Sequence:CCGGGCTGAGGTGGGAGGATCATTTCTCGAGAAATGATCCTCCCACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001055.2-346s21c1
Sequence:CCGGTGCCCTTCCTTGAGTTCAAAGCTCGAGCTTTGAACTCAAGGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1046s21c1
Sequence:CCGGACCAAGCGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-518s1c1
Sequence:CCGGAGTTTCCTACTACCACTTCTACTCGAGTAGAAGTGGTAGTAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-278s1c1
Sequence:CCGGGATTCTGGACATGATCTACCACTCGAGTGGTAGATCATGTCCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-502s1c1
Sequence:CCGGACGCAAAGGATGTGGCAGTTTCTCGAGAAACTGCCACATCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-693s1c1
Sequence:CCGGGACATGAAGGAGAACCCGAAACTCGAGTTTCGGGTTCTCCTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001055
SULT1A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1159s21c1
Sequence:CCGGAGACCAACCTGGGCAACATAGCTCGAGCTATGTTGCCCAGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1123s21c1
Sequence:CCGGGCTGAGGTGGGAGGATCATTTCTCGAGAAATGATCCTCCCACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001055.2-346s21c1
Sequence:CCGGTGCCCTTCCTTGAGTTCAAAGCTCGAGCTTTGAACTCAAGGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1046s21c1
Sequence:CCGGACCAAGCGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-518s1c1
Sequence:CCGGAGTTTCCTACTACCACTTCTACTCGAGTAGAAGTGGTAGTAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-278s1c1
Sequence:CCGGGATTCTGGACATGATCTACCACTCGAGTGGTAGATCATGTCCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-502s1c1
Sequence:CCGGACGCAAAGGATGTGGCAGTTTCTCGAGAAACTGCCACATCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-693s1c1
Sequence:CCGGGACATGAAGGAGAACCCGAAACTCGAGTTTCGGGTTCTCCTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001055
SULT1A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1159s21c1
Sequence:CCGGAGACCAACCTGGGCAACATAGCTCGAGCTATGTTGCCCAGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1123s21c1
Sequence:CCGGGCTGAGGTGGGAGGATCATTTCTCGAGAAATGATCCTCCCACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001055.2-346s21c1
Sequence:CCGGTGCCCTTCCTTGAGTTCAAAGCTCGAGCTTTGAACTCAAGGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001055.2-1046s21c1
Sequence:CCGGACCAAGCGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-518s1c1
Sequence:CCGGAGTTTCCTACTACCACTTCTACTCGAGTAGAAGTGGTAGTAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-278s1c1
Sequence:CCGGGATTCTGGACATGATCTACCACTCGAGTGGTAGATCATGTCCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-502s1c1
Sequence:CCGGACGCAAAGGATGTGGCAGTTTCTCGAGAAACTGCCACATCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001055.2-693s1c1
Sequence:CCGGGACATGAAGGAGAACCCGAAACTCGAGTTTCGGGTTCTCCTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133670
SULT1A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133670.1-1084s1c1
Sequence:CCGGGCTGTCAAATATGAGTGGATACTCGAGTATCCACTCATATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-607s1c1
Sequence:CCGGCCTGTTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-795s1c1
Sequence:CCGGCCACACTATTTCTCCCTTCATCTCGAGATGAAGGGAGAAATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-318s1c1
Sequence:CCGGCCCAGGTCTTGAAACTCTGAACTCGAGTTCAGAGTTTCAAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-207s1c1
Sequence:CCGGGATGAGTGAGATCATGGATATCTCGAGATATCCATGATCTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133670
SULT1A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133670.1-1084s1c1
Sequence:CCGGGCTGTCAAATATGAGTGGATACTCGAGTATCCACTCATATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-607s1c1
Sequence:CCGGCCTGTTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-795s1c1
Sequence:CCGGCCACACTATTTCTCCCTTCATCTCGAGATGAAGGGAGAAATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-318s1c1
Sequence:CCGGCCCAGGTCTTGAAACTCTGAACTCGAGTTCAGAGTTTCAAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-207s1c1
Sequence:CCGGGATGAGTGAGATCATGGATATCTCGAGATATCCATGATCTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133670
SULT1A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133670.1-1084s1c1
Sequence:CCGGGCTGTCAAATATGAGTGGATACTCGAGTATCCACTCATATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-607s1c1
Sequence:CCGGCCTGTTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-795s1c1
Sequence:CCGGCCACACTATTTCTCCCTTCATCTCGAGATGAAGGGAGAAATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-318s1c1
Sequence:CCGGCCCAGGTCTTGAAACTCTGAACTCGAGTTCAGAGTTTCAAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133670.1-207s1c1
Sequence:CCGGGATGAGTGAGATCATGGATATCTCGAGATATCCATGATCTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks