EMAIL THIS PAGE TO A FRIEND

SULT1A2

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2

Synonyms: HAST4 P-PST ST1A2 STP2 TSPST2
Species: Human SULT1A2(6799)
UniProtKB ID: P50226, A9QY25, P78393, Q14CJ7
Gene ID:
Human(6799) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Two alternatively spliced variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001054 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127431 MISSION® esiRNA esiRNA human SULT1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001054 Rosetta Predictions human pricing
NM_177528 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217462 predicted 724
2 SASI_Hs01_00217463 predicted 728
3 SASI_Hs01_00217464 predicted 515
4 SASI_Hs01_00217465 predicted 86
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369363 predicted 1078
2 SASI_Hs02_00369364 predicted 1064
3 SASI_Hs02_00369365 predicted 1074
4 SASI_Hs02_00369366 predicted 1071
5 SASI_Hs02_00369367 predicted 1063
6 SASI_Hs01_00242364 predicted 1004
7 SASI_Hs01_00242367 predicted 356
8 SASI_Hs01_00242365 predicted 1002
9 SASI_Hs01_00242366 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001054
SULT1A2 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-325s1c1
Sequence:CCGGGAGTTCAAAGTCCCAGGGATTCTCGAGAATCCCTGGGACTTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-767s1c1
Sequence:CCGGAGGAGATGAAGAAGAACCCTACTCGAGTAGGGTTCTTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-439s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-637s1c1
Sequence:CCGGCCTGTTCTCTACCTCTTCTATCTCGAGATAGAAGAGGTAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-130s1c1
Sequence:CCGGGTCCCGCTCATCAAGTACTTTCTCGAGAAAGTACTTGATGAGCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-506s21c1
Sequence:CCGGACCACATGGCCAAAGTGTACCCTCGAGGGTACACTTTGGCCATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-483s21c1
Sequence:CCGGGGCGGTTTCCTACTACCACTTCTCGAGAAGTGGTAGTAGGAAACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-733s21c1
Sequence:CCGGACTGTGGACCTCATGGTTGAGCTCGAGCTCAACCATGAGGTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-899s21c1
Sequence:CCGGAGCGCTTCGATGCGGACTATGCTCGAGCATAGTCCGCATCGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-244s21c1
Sequence:CCGGCAGATTCTGGACATGATCTACCTCGAGGTAGATCATGTCCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001054
SULT1A2 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-325s1c1
Sequence:CCGGGAGTTCAAAGTCCCAGGGATTCTCGAGAATCCCTGGGACTTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-767s1c1
Sequence:CCGGAGGAGATGAAGAAGAACCCTACTCGAGTAGGGTTCTTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-439s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-637s1c1
Sequence:CCGGCCTGTTCTCTACCTCTTCTATCTCGAGATAGAAGAGGTAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-130s1c1
Sequence:CCGGGTCCCGCTCATCAAGTACTTTCTCGAGAAAGTACTTGATGAGCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-506s21c1
Sequence:CCGGACCACATGGCCAAAGTGTACCCTCGAGGGTACACTTTGGCCATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-483s21c1
Sequence:CCGGGGCGGTTTCCTACTACCACTTCTCGAGAAGTGGTAGTAGGAAACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-733s21c1
Sequence:CCGGACTGTGGACCTCATGGTTGAGCTCGAGCTCAACCATGAGGTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-899s21c1
Sequence:CCGGAGCGCTTCGATGCGGACTATGCTCGAGCATAGTCCGCATCGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-244s21c1
Sequence:CCGGCAGATTCTGGACATGATCTACCTCGAGGTAGATCATGTCCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001054
SULT1A2 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-325s1c1
Sequence:CCGGGAGTTCAAAGTCCCAGGGATTCTCGAGAATCCCTGGGACTTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-767s1c1
Sequence:CCGGAGGAGATGAAGAAGAACCCTACTCGAGTAGGGTTCTTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-439s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-637s1c1
Sequence:CCGGCCTGTTCTCTACCTCTTCTATCTCGAGATAGAAGAGGTAGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001054.2-130s1c1
Sequence:CCGGGTCCCGCTCATCAAGTACTTTCTCGAGAAAGTACTTGATGAGCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-506s21c1
Sequence:CCGGACCACATGGCCAAAGTGTACCCTCGAGGGTACACTTTGGCCATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-483s21c1
Sequence:CCGGGGCGGTTTCCTACTACCACTTCTCGAGAAGTGGTAGTAGGAAACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-733s21c1
Sequence:CCGGACTGTGGACCTCATGGTTGAGCTCGAGCTCAACCATGAGGTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-899s21c1
Sequence:CCGGAGCGCTTCGATGCGGACTATGCTCGAGCATAGTCCGCATCGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001054.3-244s21c1
Sequence:CCGGCAGATTCTGGACATGATCTACCTCGAGGTAGATCATGTCCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks