EMAIL THIS PAGE TO A FRIEND

SULT1A3

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3

Synonyms: HAST HAST3 M-PST ST1A3/ST1A4 ST1A5 STM TL-PST
Species: Human SULT1A3(6818)
UniProtKB ID: P50224, B4DNV0, O95603, Q6ZWJ5
Gene ID:
Human(6818) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003166 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017387 Rosetta Predictions human pricing
NM_003166 Rosetta Predictions human pricing
NM_177552 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098276 predicted 554
2 SASI_Hs01_00098277 predicted 548
3 SASI_Hs01_00098278 predicted 786
4 SASI_Hs01_00098279 predicted 508
5 SASI_Hs01_00098280 predicted 545
6 SASI_Hs01_00098281 predicted 528
7 SASI_Hs01_00098282 predicted 366
8 SASI_Hs01_00098283 predicted 338
9 SASI_Hs01_00098284 predicted 787
10 SASI_Hs01_00098285 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150198 predicted 711
2 SASI_Hs01_00150199 predicted 720
3 SASI_Hs01_00150200 predicted 948
4 SASI_Hs01_00150201 predicted 677
5 SASI_Hs01_00150202 predicted 707
6 SASI_Hs01_00150203 predicted 685
7 SASI_Hs01_00150204 predicted 534
8 SASI_Hs01_00150205 predicted 505
9 SASI_Hs01_00150206 predicted 951
10 SASI_Hs01_00150207 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033269 predicted 536
2 SASI_Hs01_00033270 predicted 531
3 SASI_Hs01_00033271 predicted 772
4 SASI_Hs01_00033272 predicted 489
5 SASI_Hs01_00033273 predicted 527
6 SASI_Hs01_00033274 predicted 510
7 SASI_Hs01_00033275 predicted 348
8 SASI_Hs01_00033276 predicted 315
9 SASI_Hs01_00033277 predicted 762
10 SASI_Hs01_00033278 predicted 1054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003166
SULT1A3 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1289s21c1
Sequence:CCGGGTCTGCAATCCCAGCGATTTGCTCGAGCAAATCGCTGGGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-645s21c1
Sequence:CCGGTCAGACTCTGTTGGATCAGAACTCGAGTTCTGATCCAACAGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-969s21c1
Sequence:CCGGGGTTCAGCACACGTCGTTCAACTCGAGTTGAACGACGTGTGCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1236s21c1
Sequence:CCGGACCAATGGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-618s1c1
Sequence:CCGGCCTACTACCATTTCCACCGTACTCGAGTACGGTGGAAATGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-443s1c1
Sequence:CCGGCCCTTCCTTGAGGTCAATGATCTCGAGATCATTGACCTCAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-396s1c1
Sequence:CCGGGCGGCGACCTAGAGAAGTGTACTCGAGTACACTTCTCTAGGTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-775s1c1
Sequence:CCGGCCTCTTCTATGAAGACATGAACTCGAGTTCATGTCTTCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003166
SULT1A3 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1289s21c1
Sequence:CCGGGTCTGCAATCCCAGCGATTTGCTCGAGCAAATCGCTGGGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-645s21c1
Sequence:CCGGTCAGACTCTGTTGGATCAGAACTCGAGTTCTGATCCAACAGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-969s21c1
Sequence:CCGGGGTTCAGCACACGTCGTTCAACTCGAGTTGAACGACGTGTGCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1236s21c1
Sequence:CCGGACCAATGGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-618s1c1
Sequence:CCGGCCTACTACCATTTCCACCGTACTCGAGTACGGTGGAAATGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-443s1c1
Sequence:CCGGCCCTTCCTTGAGGTCAATGATCTCGAGATCATTGACCTCAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-396s1c1
Sequence:CCGGGCGGCGACCTAGAGAAGTGTACTCGAGTACACTTCTCTAGGTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-775s1c1
Sequence:CCGGCCTCTTCTATGAAGACATGAACTCGAGTTCATGTCTTCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003166
SULT1A3 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1289s21c1
Sequence:CCGGGTCTGCAATCCCAGCGATTTGCTCGAGCAAATCGCTGGGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-645s21c1
Sequence:CCGGTCAGACTCTGTTGGATCAGAACTCGAGTTCTGATCCAACAGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003166.3-969s21c1
Sequence:CCGGGGTTCAGCACACGTCGTTCAACTCGAGTTGAACGACGTGTGCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003166.3-1236s21c1
Sequence:CCGGACCAATGGGCTCAAGAATAAACTCGAGTTTATTCTTGAGCCCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-618s1c1
Sequence:CCGGCCTACTACCATTTCCACCGTACTCGAGTACGGTGGAAATGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-443s1c1
Sequence:CCGGCCCTTCCTTGAGGTCAATGATCTCGAGATCATTGACCTCAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-396s1c1
Sequence:CCGGGCGGCGACCTAGAGAAGTGTACTCGAGTACACTTCTCTAGGTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003166.2-775s1c1
Sequence:CCGGCCTCTTCTATGAAGACATGAACTCGAGTTCATGTCTTCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks