EMAIL THIS PAGE TO A FRIEND

SULT1A4

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4

Synonyms: HAST3 M-PST ST1A3/ST1A4 TL-PST
Species: Human SULT1A4(445329)
Gene ID:
Human(445329) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017389 Rosetta Predictions human pricing
NM_001017390 Rosetta Predictions human pricing
NM_001017391 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053700 predicted 711
2 SASI_Hs01_00053701 predicted 714
3 SASI_Hs01_00053702 predicted 948
4 SASI_Hs01_00053703 predicted 672
5 SASI_Hs01_00053704 predicted 709
6 SASI_Hs01_00053705 predicted 694
7 SASI_Hs01_00053706 predicted 537
8 SASI_Hs01_00053707 predicted 504
9 SASI_Hs01_00053708 predicted 950
10 SASI_Hs01_00053709 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073823 predicted 535
2 SASI_Hs01_00073824 predicted 536
3 SASI_Hs01_00073825 predicted 764
4 SASI_Hs01_00073826 predicted 493
5 SASI_Hs01_00073827 predicted 526
6 SASI_Hs01_00073828 predicted 506
7 SASI_Hs01_00073829 predicted 353
8 SASI_Hs01_00073830 predicted 319
9 SASI_Hs01_00073831 predicted 766
10 SASI_Hs01_00073832 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030655 predicted 556
2 SASI_Hs01_00030656 predicted 554
3 SASI_Hs01_00030657 predicted 783
4 SASI_Hs01_00030658 predicted 509
5 SASI_Hs01_00030659 predicted 543
6 SASI_Hs01_00030660 predicted 523
7 SASI_Hs01_00030661 predicted 375
8 SASI_Hs01_00030662 predicted 340
9 SASI_Hs01_00030663 predicted 788
10 SASI_Hs01_00030664 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017391
SULT1A4 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000181155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017391.1-498s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017391
SULT1A4 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000181155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017391.1-498s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017391
SULT1A4 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000181155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017391.1-498s1c1
Sequence:CCGGCAGAAGGTCAAGGTGGTCTATCTCGAGATAGACCACCTTGACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017389
SULT1A4 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-353s21c1
Sequence:CCGGTCCCGCTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017389.1-1328s21c1
Sequence:CCGGATCACAATAGGCCACGAATTTCTCGAGAAATTCGTGGCCTATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-662s21c1
Sequence:CCGGAGAAGGTCAAGGTGGTCTATGCTCGAGCATAGACCACCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-493s21c1
Sequence:CCGGGGCGACCTAGAGAAGTGTAACCTCGAGGTTACACTTCTCTAGGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-705s21c1
Sequence:CCGGGGCGGTCTCCTACTACCATTTCTCGAGAAATGGTAGTAGGAGACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017389
SULT1A4 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-353s21c1
Sequence:CCGGTCCCGCTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017389.1-1328s21c1
Sequence:CCGGATCACAATAGGCCACGAATTTCTCGAGAAATTCGTGGCCTATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-662s21c1
Sequence:CCGGAGAAGGTCAAGGTGGTCTATGCTCGAGCATAGACCACCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-493s21c1
Sequence:CCGGGGCGACCTAGAGAAGTGTAACCTCGAGGTTACACTTCTCTAGGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-705s21c1
Sequence:CCGGGGCGGTCTCCTACTACCATTTCTCGAGAAATGGTAGTAGGAGACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017389
SULT1A4 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-353s21c1
Sequence:CCGGTCCCGCTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017389.1-1328s21c1
Sequence:CCGGATCACAATAGGCCACGAATTTCTCGAGAAATTCGTGGCCTATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-662s21c1
Sequence:CCGGAGAAGGTCAAGGTGGTCTATGCTCGAGCATAGACCACCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-493s21c1
Sequence:CCGGGGCGACCTAGAGAAGTGTAACCTCGAGGTTACACTTCTCTAGGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017389.1-705s21c1
Sequence:CCGGGGCGGTCTCCTACTACCATTTCTCGAGAAATGGTAGTAGGAGACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks