EMAIL THIS PAGE TO A FRIEND

SULT1B1

sulfotransferase family, cytosolic, 1B, member 1

Synonyms: ST1B1 ST1B2 SULT1B2
UniProtKB ID: O43704, O15497, Q96FI1, Q9UK34
Gene ID:
Human(27284) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. However, the total genomic length of this gene is greater than that of other SULT1 genes. [provided by RefSeq, Jul 2008]
Mouse(56362) sulfotransferase family 1B, member 1
Rat(64305) sulfotransferase family, cytosolic, 1B, member 1
chicken(395227) sulfotransferase family, cytosolic, 1B, member 1
chicken(422661) sulfotransferase family, cytosolic, 1B, member 1
dog(403636) sulfotransferase family, cytosolic, 1B, member 1
domestic cat(101086803) sulfotransferase family, cytosolic, 1B, member 1
cow(521920) sulfotransferase family, cytosolic, 1B, member 1
sheep(101120084) sulfotransferase family, cytosolic, 1B, member 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1727 Human SULT1B1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119341 MISSION® esiRNA esiRNA human SULT1B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014465 Rosetta Predictions human pricing
NM_022513 Rosetta Predictions rat pricing
NM_019878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188551 predicted 397
2 SASI_Hs01_00188552 predicted 695
3 SASI_Hs01_00188553 predicted 1033
4 SASI_Hs01_00188554 predicted 997
5 SASI_Hs01_00188555 predicted 556
6 SASI_Hs01_00188556 predicted 329
7 SASI_Hs01_00188557 predicted 418
8 SASI_Hs01_00188558 predicted 413
9 SASI_Hs01_00188559 predicted 897
10 SASI_Hs01_00188560 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064532 predicted 951
2 SASI_Rn01_00064533 predicted 489
3 SASI_Rn01_00064534 predicted 923
4 SASI_Rn01_00064535 predicted 439
5 SASI_Rn01_00064537 predicted 927
6 SASI_Rn01_00064538 predicted 564
7 SASI_Rn01_00064539 predicted 236
8 SASI_Rn01_00064540 predicted 413
9 SASI_Rn01_00064541 predicted 219
10 SASI_Rn02_00263252 predicted 391
11 SASI_Rn01_00064536 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055956 predicted 476
2 SASI_Mm01_00055957 predicted 993
3 SASI_Mm01_00055958 predicted 240
4 SASI_Mm01_00055959 predicted 950
5 SASI_Mm01_00055960 predicted 217
6 SASI_Mm01_00055961 predicted 654
7 SASI_Mm01_00055962 predicted 531
8 SASI_Mm01_00055963 predicted 579
9 SASI_Mm01_00055964 predicted 605
10 SASI_Mm01_00055965 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014465
SULT1B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1B, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-674s21c1
Sequence:CCGGATGATTTATCTGGCTCGTAATCTCGAGATTACGAGCCAGATAAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-333s21c1
Sequence:CCGGTGAAGTTGGTCCATGGTTATCCTCGAGGATAACCATGGACCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-448s21c1
Sequence:CCGGTACTACTTGGGTTAGTGAAATCTCGAGATTTCACTAACCCAAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-1001s21c1
Sequence:CCGGGACAATCCTTTGGTAAATTATCTCGAGATAATTTACCAAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-628s1c1
Sequence:CCGGCGACTGATCTTCTTCCTAAATCTCGAGATTTAGGAAGAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-414s1c1
Sequence:CCGGGACATTGTGATAGCCACTTATCTCGAGATAAGTGGCTATCACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-761s1c1
Sequence:CCGGCTGGGAAGAATATCTGGAGAACTCGAGTTCTCCAGATATTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-1029s1c1
Sequence:CCGGCCAACTACAGTGATGGATCATCTCGAGATGATCCATCACTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-694s1c1
Sequence:CCGGCCAAGGATGTTTCAGTCTCATCTCGAGATGAGACTGAAACATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014465
SULT1B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1B, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-674s21c1
Sequence:CCGGATGATTTATCTGGCTCGTAATCTCGAGATTACGAGCCAGATAAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-333s21c1
Sequence:CCGGTGAAGTTGGTCCATGGTTATCCTCGAGGATAACCATGGACCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-448s21c1
Sequence:CCGGTACTACTTGGGTTAGTGAAATCTCGAGATTTCACTAACCCAAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-1001s21c1
Sequence:CCGGGACAATCCTTTGGTAAATTATCTCGAGATAATTTACCAAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-628s1c1
Sequence:CCGGCGACTGATCTTCTTCCTAAATCTCGAGATTTAGGAAGAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-414s1c1
Sequence:CCGGGACATTGTGATAGCCACTTATCTCGAGATAAGTGGCTATCACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-761s1c1
Sequence:CCGGCTGGGAAGAATATCTGGAGAACTCGAGTTCTCCAGATATTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-1029s1c1
Sequence:CCGGCCAACTACAGTGATGGATCATCTCGAGATGATCCATCACTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-694s1c1
Sequence:CCGGCCAAGGATGTTTCAGTCTCATCTCGAGATGAGACTGAAACATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014465
SULT1B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1B, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-674s21c1
Sequence:CCGGATGATTTATCTGGCTCGTAATCTCGAGATTACGAGCCAGATAAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-333s21c1
Sequence:CCGGTGAAGTTGGTCCATGGTTATCCTCGAGGATAACCATGGACCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-448s21c1
Sequence:CCGGTACTACTTGGGTTAGTGAAATCTCGAGATTTCACTAACCCAAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014465.3-1001s21c1
Sequence:CCGGGACAATCCTTTGGTAAATTATCTCGAGATAATTTACCAAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-628s1c1
Sequence:CCGGCGACTGATCTTCTTCCTAAATCTCGAGATTTAGGAAGAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-414s1c1
Sequence:CCGGGACATTGTGATAGCCACTTATCTCGAGATAAGTGGCTATCACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-761s1c1
Sequence:CCGGCTGGGAAGAATATCTGGAGAACTCGAGTTCTCCAGATATTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-1029s1c1
Sequence:CCGGCCAACTACAGTGATGGATCATCTCGAGATGATCCATCACTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014465.2-694s1c1
Sequence:CCGGCCAAGGATGTTTCAGTCTCATCTCGAGATGAGACTGAAACATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019878
SULT1B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1B, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019878.2-2152s1c1
Sequence:CCGGGCTGCTTCATAACATGGTTTACTCGAGTAAACCATGTTATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-416s1c1
Sequence:CCGGCGGATAATAAAGACACATCTTCTCGAGAAGATGTGTCTTTATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-272s1c1
Sequence:CCGGGAGATTGTAGACATGGTTCTACTCGAGTAGAACCATGTCTACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-929s1c1
Sequence:CCGGGAGCAATTTGATGCTGTCTATCTCGAGATAGACAGCATCAAATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-213s1c1
Sequence:CCGGGCACACCAGGTGACATTGTAACTCGAGTTACAATGTCACCTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019878
SULT1B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1B, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019878.2-2152s1c1
Sequence:CCGGGCTGCTTCATAACATGGTTTACTCGAGTAAACCATGTTATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-416s1c1
Sequence:CCGGCGGATAATAAAGACACATCTTCTCGAGAAGATGTGTCTTTATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-272s1c1
Sequence:CCGGGAGATTGTAGACATGGTTCTACTCGAGTAGAACCATGTCTACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-929s1c1
Sequence:CCGGGAGCAATTTGATGCTGTCTATCTCGAGATAGACAGCATCAAATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-213s1c1
Sequence:CCGGGCACACCAGGTGACATTGTAACTCGAGTTACAATGTCACCTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019878
SULT1B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1B, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019878.2-2152s1c1
Sequence:CCGGGCTGCTTCATAACATGGTTTACTCGAGTAAACCATGTTATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-416s1c1
Sequence:CCGGCGGATAATAAAGACACATCTTCTCGAGAAGATGTGTCTTTATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-272s1c1
Sequence:CCGGGAGATTGTAGACATGGTTCTACTCGAGTAGAACCATGTCTACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-929s1c1
Sequence:CCGGGAGCAATTTGATGCTGTCTATCTCGAGATAGACAGCATCAAATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019878.2-213s1c1
Sequence:CCGGGCACACCAGGTGACATTGTAACTCGAGTTACAATGTCACCTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks