EMAIL THIS PAGE TO A FRIEND

SULT1C2

sulfotransferase family, cytosolic, 1C, member 2

Synonyms: ST1C1 ST1C2 SULT1C1 humSULTC2
UniProtKB ID: O00338, B2R813, Q53SG4
Gene ID:
Human(6819) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(69083) sulfotransferase family, cytosolic, 1C, member 2
Rat(171072) sulfotransferase family, cytosolic, 1C, member 2
cow(523898) sulfotransferase family, cytosolic, 1C, member 2
sheep(101116036) sulfotransferase family, cytosolic, 1C, member 2
domestic guinea pig(100729651) sulfotransferase family, cytosolic, 1C, member 2
naked mole-rat(101724519) sulfotransferase family, cytosolic, 1C, member 2
domestic cat(101097138) sulfotransferase family, cytosolic, 1C, member 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1728 Human SULT1C2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001056 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089581 MISSION® esiRNA esiRNA human SULT1C2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001056 Rosetta Predictions human pricing
NM_176825 Rosetta Predictions human pricing
NM_133547 Rosetta Predictions rat pricing
NM_026935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227739 predicted 1423
2 SASI_Hs01_00227740 predicted 1477
3 SASI_Hs01_00227741 predicted 1159
4 SASI_Hs01_00227742 predicted 1479
5 SASI_Hs01_00227743 predicted 1097
6 SASI_Hs01_00227744 predicted 1421
7 SASI_Hs01_00227745 predicted 1099
8 SASI_Hs01_00227746 predicted 1301
9 SASI_Hs01_00227747 predicted 1548
10 SASI_Hs01_00227748 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232935 predicted 1451
2 SASI_Hs01_00232936 predicted 1511
3 SASI_Hs01_00232937 predicted 1193
4 SASI_Hs01_00232938 predicted 1513
5 SASI_Hs01_00232939 predicted 1132
6 SASI_Hs01_00232940 predicted 1450
7 SASI_Hs01_00232941 predicted 1125
8 SASI_Hs01_00232942 predicted 1328
9 SASI_Hs01_00232943 predicted 1581
10 SASI_Hs01_00232944 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075022 predicted 1190
2 SASI_Rn01_00075023 predicted 1208
3 SASI_Rn01_00075024 predicted 1130
4 SASI_Rn01_00075027 predicted 832
5 SASI_Rn01_00075031 predicted 314
6 SASI_Rn01_00075025 predicted 1063
7 SASI_Rn01_00075026 predicted 892
8 SASI_Rn01_00075028 predicted 260
9 SASI_Rn01_00075029 predicted 469
10 SASI_Rn01_00075030 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171814 predicted 747
2 SASI_Mm01_00171816 predicted 904
3 SASI_Mm02_00331229 predicted 840
4 SASI_Mm01_00171817 predicted 852
5 SASI_Mm01_00171818 predicted 734
6 SASI_Mm01_00171819 predicted 790
7 SASI_Mm01_00171820 predicted 1039
8 SASI_Mm01_00171821 predicted 981
9 SASI_Mm01_00171822 predicted 565
10 SASI_Mm01_00171823 predicted 1095
11 SASI_Mm01_00171815 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026935
VALIDATED
SULT1C2 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1C, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-747s21c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-836s21c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-571s21c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-516s21c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026935.4-1240s21c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026935.3-1240s1c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-836s1c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026935.3-571s1c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-516s1c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-747s1c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026935
VALIDATED
SULT1C2 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1C, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-747s21c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-836s21c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-571s21c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-516s21c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026935.4-1240s21c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026935.3-1240s1c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-836s1c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026935.3-571s1c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-516s1c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-747s1c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026935
VALIDATED
SULT1C2 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1C, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-747s21c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-836s21c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-571s21c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026935.4-516s21c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026935.4-1240s21c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026935.3-1240s1c1
Sequence:CCGGGCAGATCATGTCCAATGTATACTCGAGTATACATTGGACATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-836s1c1
Sequence:CCGGGCAGTTTATGGGCAAGAATTTCTCGAGAAATTCTTGCCCATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026935.3-571s1c1
Sequence:CCGGCAAACAACTGTAAGTTCCTTTCTCGAGAAAGGAACTTACAGTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-516s1c1
Sequence:CCGGCCAAGGATATTAAGGACCCATCTCGAGATGGGTCCTTAATATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026935.3-747s1c1
Sequence:CCGGTGGTGGGAAATTCGAGACAAACTCGAGTTTGTCTCGAATTTCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001056
SULT1C2 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1C, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001056.3-2441s1c1
Sequence:CCGGGCAGACAATAAGAGGAAGAATCTCGAGATTCTTCCTCTTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1267s1c1
Sequence:CCGGGCCCAGAATGAGAGGTTTGATCTCGAGATCAAACCTCTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-628s1c1
Sequence:CCGGGTGGATATGATTGAACAGAATCTCGAGATTCTGTTCAATCATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1059s1c1
Sequence:CCGGGCATGAAATTCGGAAGGTGATCTCGAGATCACCTTCCGAATTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-763s1c1
Sequence:CCGGCGGATACTAAAGACTCACCTTCTCGAGAAGGTGAGTCTTTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001056
SULT1C2 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1C, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001056.3-2441s1c1
Sequence:CCGGGCAGACAATAAGAGGAAGAATCTCGAGATTCTTCCTCTTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1267s1c1
Sequence:CCGGGCCCAGAATGAGAGGTTTGATCTCGAGATCAAACCTCTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-628s1c1
Sequence:CCGGGTGGATATGATTGAACAGAATCTCGAGATTCTGTTCAATCATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1059s1c1
Sequence:CCGGGCATGAAATTCGGAAGGTGATCTCGAGATCACCTTCCGAATTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-763s1c1
Sequence:CCGGCGGATACTAAAGACTCACCTTCTCGAGAAGGTGAGTCTTTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001056
SULT1C2 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1C, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001056.3-2441s1c1
Sequence:CCGGGCAGACAATAAGAGGAAGAATCTCGAGATTCTTCCTCTTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1267s1c1
Sequence:CCGGGCCCAGAATGAGAGGTTTGATCTCGAGATCAAACCTCTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-628s1c1
Sequence:CCGGGTGGATATGATTGAACAGAATCTCGAGATTCTGTTCAATCATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-1059s1c1
Sequence:CCGGGCATGAAATTCGGAAGGTGATCTCGAGATCACCTTCCGAATTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001056.3-763s1c1
Sequence:CCGGCGGATACTAAAGACTCACCTTCTCGAGAAGGTGAGTCTTTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks