EMAIL THIS PAGE TO A FRIEND

SULT1C3

sulfotransferase family, cytosolic, 1C, member 3

Synonyms: ST1C3
UniProtKB ID: Q6IMI6, Q6IMI5
Gene ID:
Rat(65185) sulfotransferase family, cytosolic, 1C, member 3
chicken(395300) sulfotransferase family, cytosolic, 1C, member 3
dog(481309) sulfotransferase family, cytosolic, 1C, member 3
cow(615528) sulfotransferase family, cytosolic, 1C, member 3
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008743 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036151 MISSION® esiRNA esiRNA human SULT1C3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008743 Rosetta Predictions human pricing
NM_031732 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130038 predicted 593
2 SASI_Hs01_00130039 predicted 502
3 SASI_Hs01_00130040 predicted 297
4 SASI_Hs01_00130041 predicted 625
5 SASI_Hs01_00130043 predicted 624
6 SASI_Hs01_00130044 predicted 240
7 SASI_Hs01_00130045 predicted 345
8 SASI_Hs01_00130046 predicted 637
9 SASI_Hs01_00130047 predicted 403
10 SASI_Hs02_00305554 predicted 362
11 SASI_Hs01_00130042 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107835 predicted 537
2 SASI_Rn01_00107836 predicted 723
3 SASI_Rn01_00107837 predicted 872
4 SASI_Rn01_00107839 predicted 453
5 SASI_Rn01_00107840 predicted 884
6 SASI_Rn01_00107841 predicted 744
7 SASI_Rn02_00265115 predicted 605
8 SASI_Rn01_00107842 predicted 445
9 SASI_Rn01_00107844 predicted 933
10 SASI_Rn02_00265116 predicted 352
11 SASI_Rn01_00107838 predicted 973
12 SASI_Rn01_00107843 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008743
SULT1C3 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1C, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-762s1c1
Sequence:CCGGCAGCATTATGGACCACTCCATCTCGAGATGGAGTGGTCCATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-250s1c1
Sequence:CCGGCTAGATAGACACGCTTTCCTTCTCGAGAAGGAAAGCGTGTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-399s1c1
Sequence:CCGGGATTGTCTATGTGGCCAGAAACTCGAGTTTCTGGCCACATAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-481s1c1
Sequence:CCGGCCTCAGAACTTAGAGGAATTTCTCGAGAAATTCCTCTAAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-710s1c1
Sequence:CCGGCCTTTGATGTAATGAAGCAAACTCGAGTTTGCTTCATTACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008743
SULT1C3 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1C, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-762s1c1
Sequence:CCGGCAGCATTATGGACCACTCCATCTCGAGATGGAGTGGTCCATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-250s1c1
Sequence:CCGGCTAGATAGACACGCTTTCCTTCTCGAGAAGGAAAGCGTGTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-399s1c1
Sequence:CCGGGATTGTCTATGTGGCCAGAAACTCGAGTTTCTGGCCACATAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-481s1c1
Sequence:CCGGCCTCAGAACTTAGAGGAATTTCTCGAGAAATTCCTCTAAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-710s1c1
Sequence:CCGGCCTTTGATGTAATGAAGCAAACTCGAGTTTGCTTCATTACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008743
SULT1C3 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1C, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-762s1c1
Sequence:CCGGCAGCATTATGGACCACTCCATCTCGAGATGGAGTGGTCCATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-250s1c1
Sequence:CCGGCTAGATAGACACGCTTTCCTTCTCGAGAAGGAAAGCGTGTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-399s1c1
Sequence:CCGGGATTGTCTATGTGGCCAGAAACTCGAGTTTCTGGCCACATAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-481s1c1
Sequence:CCGGCCTCAGAACTTAGAGGAATTTCTCGAGAAATTCCTCTAAGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008743.1-710s1c1
Sequence:CCGGCCTTTGATGTAATGAAGCAAACTCGAGTTTGCTTCATTACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks