EMAIL THIS PAGE TO A FRIEND

SULT1C4

sulfotransferase family, cytosolic, 1C, member 4

Synonyms: SULT1C SULT1C2
UniProtKB ID: O75897, Q069I8, Q53S63
Gene ID:
Human(27233) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. [provided by RefSeq, Jul 2008]
cow(509792) sulfotransferase family, cytosolic, 1C, member 4
cow(783020) sulfotransferase family, cytosolic, 1C, member 4
cow(537919) sulfotransferase family, cytosolic, 1C, member 4
Domestic Rabbit(100009458) sulfotransferase family, cytosolic, 1C, member 4
dog(474542) sulfotransferase family, cytosolic, 1C, member 4
domestic cat(101096881) sulfotransferase family, cytosolic, 1C, member 4
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006588 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149931 MISSION® esiRNA esiRNA human SULT1C4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006588 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341891 predicted 1185
2 SASI_Hs01_00188163 predicted 1087
3 SASI_Hs01_00188165 predicted 1198
4 SASI_Hs01_00188166 predicted 1089
5 SASI_Hs01_00188167 predicted 1073
6 SASI_Hs02_00341892 predicted 708
7 SASI_Hs01_00188168 predicted 1255
8 SASI_Hs01_00188169 predicted 970
9 SASI_Hs01_00188170 predicted 1242
10 SASI_Hs02_00341893 predicted 1354
11 SASI_Hs01_00188161 predicted 560
12 SASI_Hs01_00188162 predicted 792
13 SASI_Hs01_00188164 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006588
SULT1C4 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 1C, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-615s1c1
Sequence:CCGGCGACTCATCAACGATTTCCTTCTCGAGAAGGAAATCGTTGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-1201s1c1
Sequence:CCGGCGTGGCTCAGAATGAGAGATTCTCGAGAATCTCTCATTCTGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-953s1c1
Sequence:CCGGCGTATTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-517s1c1
Sequence:CCGGGCTTATTTCTACCTATCCTAACTCGAGTTAGGATAGGTAGAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1319s21c1
Sequence:CCGGCCAGTATATTTGGGTAATAATCTCGAGATTATTACCCAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1403s21c1
Sequence:CCGGGCTCTTATTCACTCTACTAAACTCGAGTTTAGTAGAGTGAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006588
SULT1C4 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 1C, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-615s1c1
Sequence:CCGGCGACTCATCAACGATTTCCTTCTCGAGAAGGAAATCGTTGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-1201s1c1
Sequence:CCGGCGTGGCTCAGAATGAGAGATTCTCGAGAATCTCTCATTCTGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-953s1c1
Sequence:CCGGCGTATTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-517s1c1
Sequence:CCGGGCTTATTTCTACCTATCCTAACTCGAGTTAGGATAGGTAGAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1319s21c1
Sequence:CCGGCCAGTATATTTGGGTAATAATCTCGAGATTATTACCCAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1403s21c1
Sequence:CCGGGCTCTTATTCACTCTACTAAACTCGAGTTTAGTAGAGTGAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006588
SULT1C4 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 1C, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-615s1c1
Sequence:CCGGCGACTCATCAACGATTTCCTTCTCGAGAAGGAAATCGTTGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-1201s1c1
Sequence:CCGGCGTGGCTCAGAATGAGAGATTCTCGAGAATCTCTCATTCTGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-953s1c1
Sequence:CCGGCGTATTCTCTATCTCTTCTATCTCGAGATAGAAGAGATAGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006588.2-517s1c1
Sequence:CCGGGCTTATTTCTACCTATCCTAACTCGAGTTAGGATAGGTAGAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1319s21c1
Sequence:CCGGCCAGTATATTTGGGTAATAATCTCGAGATTATTACCCAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006588.2-1403s21c1
Sequence:CCGGGCTCTTATTCACTCTACTAAACTCGAGTTTAGTAGAGTGAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks