EMAIL THIS PAGE TO A FRIEND

SULT1E1

sulfotransferase family 1E, estrogen-preferring, member 1

Synonyms: EST EST-1 ST1E1 STE
UniProtKB ID: P49888, Q8N6X5
Gene ID:
Human(6783) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008]
Mouse(20860) sulfotransferase family 1E, member 1
Rat(25355) sulfotransferase family 1E, estrogen-preferring, member 1
chicken(422662) sulfotransferase family 1E, estrogen-preferring, member 1
Horse(100034106) sulfotransferase family 1E, estrogen-preferring, member 1
domestic cat(101086305) sulfotransferase family 1E, estrogen-preferring, member 1
dog(482182) sulfotransferase family 1E, estrogen-preferring, member 1
cow(280934) sulfotransferase family 1E, estrogen-preferring, member 1
sheep(101120331) sulfotransferase family 1E, estrogen-preferring, member 1
domestic guinea pig(100135625) sulfotransferase family 1E, member 1
naked mole-rat(101715367) sulfotransferase family 1E, estrogen-preferring, member 1
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046451 MISSION® esiRNA esiRNA human SULT1E1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005420 Rosetta Predictions human pricing
NM_012883 Rosetta Predictions rat pricing
NM_023135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053528 predicted 402
2 SASI_Hs01_00053529 predicted 486
3 SASI_Hs01_00053530 predicted 823
4 SASI_Hs01_00053531 predicted 604
5 SASI_Hs02_00339560 predicted 418
6 SASI_Hs01_00053532 predicted 851
7 SASI_Hs01_00053533 predicted 407
8 SASI_Hs01_00053534 predicted 833
9 SASI_Hs01_00053535 predicted 257
10 SASI_Hs01_00053536 predicted 307
11 SASI_Hs01_00053527 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057642 predicted 783
2 SASI_Rn01_00057643 predicted 915
3 SASI_Rn01_00057644 predicted 784
4 SASI_Rn01_00057645 predicted 252
5 SASI_Rn02_00260395 predicted 291
6 SASI_Rn01_00057646 predicted 633
7 SASI_Rn01_00057647 predicted 672
8 SASI_Rn01_00057648 predicted 498
9 SASI_Rn02_00260396 predicted 380
10 SASI_Rn01_00057650 predicted 700
11 SASI_Rn01_00057649 predicted 384
12 SASI_Rn01_00057651 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144549 predicted 769
2 SASI_Mm01_00144550 predicted 974
3 SASI_Mm01_00144551 predicted 652
4 SASI_Mm01_00144552 predicted 879
5 SASI_Mm02_00326844 predicted 868
6 SASI_Mm01_00144554 predicted 364
7 SASI_Mm01_00144555 predicted 812
8 SASI_Mm01_00144556 predicted 864
9 SASI_Mm01_00144557 predicted 350
10 SASI_Mm02_00326845 predicted 1017
11 SASI_Mm01_00144553 predicted 702
12 SASI_Mm01_00144558 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023135
SULT1E1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family 1E, estrogen-preferring, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023135.1-1045s1c1
Sequence:CCGGCCTTCAGTTTCTCTTGTGAATCTCGAGATTCACAAGAGAAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-160s1c1
Sequence:CCGGCGTGGAGTTCTAATGGACAAACTCGAGTTTGTCCATTAGAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-1003s1c1
Sequence:CCGGGCCACTTCCTTGTGTCTGAAACTCGAGTTTCAGACACAAGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-365s1c1
Sequence:CCGGGCAGAAACGAAGACCTAATAACTCGAGTTATTAGGTCTTCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-520s1c1
Sequence:CCGGGCCGTTTCTTATTACTACTTTCTCGAGAAAGTAGTAATAAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023135
SULT1E1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family 1E, estrogen-preferring, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023135.1-1045s1c1
Sequence:CCGGCCTTCAGTTTCTCTTGTGAATCTCGAGATTCACAAGAGAAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-160s1c1
Sequence:CCGGCGTGGAGTTCTAATGGACAAACTCGAGTTTGTCCATTAGAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-1003s1c1
Sequence:CCGGGCCACTTCCTTGTGTCTGAAACTCGAGTTTCAGACACAAGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-365s1c1
Sequence:CCGGGCAGAAACGAAGACCTAATAACTCGAGTTATTAGGTCTTCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-520s1c1
Sequence:CCGGGCCGTTTCTTATTACTACTTTCTCGAGAAAGTAGTAATAAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023135
SULT1E1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family 1E, estrogen-preferring, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023135.1-1045s1c1
Sequence:CCGGCCTTCAGTTTCTCTTGTGAATCTCGAGATTCACAAGAGAAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-160s1c1
Sequence:CCGGCGTGGAGTTCTAATGGACAAACTCGAGTTTGTCCATTAGAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-1003s1c1
Sequence:CCGGGCCACTTCCTTGTGTCTGAAACTCGAGTTTCAGACACAAGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-365s1c1
Sequence:CCGGGCAGAAACGAAGACCTAATAACTCGAGTTATTAGGTCTTCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023135.1-520s1c1
Sequence:CCGGGCCGTTTCTTATTACTACTTTCTCGAGAAAGTAGTAATAAGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005420
SULT1E1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family 1E, estrogen-preferring, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-857s1c1
Sequence:CCGGCCAGAAATTGTCGCCCTTCATCTCGAGATGAAGGGCGACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-414s1c1
Sequence:CCGGCCTAGAATTGTGAAGACTCATCTCGAGATGAGTCTTCACAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-909s1c1
Sequence:CCGGCACTTTACAGTAGCCCTGAATCTCGAGATTCAGGGCTACTGTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-155s1c1
Sequence:CCGGCCATGGGATTCTAATGTATAACTCGAGTTATACATTAGAATCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005420.2-1283s21c1
Sequence:CCGGGCAACCATGTTTGGCTAATTTCTCGAGAAATTAGCCAAACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-831s21c1
Sequence:CCGGACAACACTGCCAGACGAAATTCTCGAGAATTTCGTCTGGCAGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-472s21c1
Sequence:CCGGAGGATTGTAAGATAATCTATCCTCGAGGATAGATTATCTTACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005420
SULT1E1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family 1E, estrogen-preferring, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-857s1c1
Sequence:CCGGCCAGAAATTGTCGCCCTTCATCTCGAGATGAAGGGCGACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-414s1c1
Sequence:CCGGCCTAGAATTGTGAAGACTCATCTCGAGATGAGTCTTCACAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-909s1c1
Sequence:CCGGCACTTTACAGTAGCCCTGAATCTCGAGATTCAGGGCTACTGTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-155s1c1
Sequence:CCGGCCATGGGATTCTAATGTATAACTCGAGTTATACATTAGAATCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005420.2-1283s21c1
Sequence:CCGGGCAACCATGTTTGGCTAATTTCTCGAGAAATTAGCCAAACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-831s21c1
Sequence:CCGGACAACACTGCCAGACGAAATTCTCGAGAATTTCGTCTGGCAGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-472s21c1
Sequence:CCGGAGGATTGTAAGATAATCTATCCTCGAGGATAGATTATCTTACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005420
SULT1E1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family 1E, estrogen-preferring, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-857s1c1
Sequence:CCGGCCAGAAATTGTCGCCCTTCATCTCGAGATGAAGGGCGACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-414s1c1
Sequence:CCGGCCTAGAATTGTGAAGACTCATCTCGAGATGAGTCTTCACAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-909s1c1
Sequence:CCGGCACTTTACAGTAGCCCTGAATCTCGAGATTCAGGGCTACTGTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005420.2-155s1c1
Sequence:CCGGCCATGGGATTCTAATGTATAACTCGAGTTATACATTAGAATCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005420.2-1283s21c1
Sequence:CCGGGCAACCATGTTTGGCTAATTTCTCGAGAAATTAGCCAAACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-831s21c1
Sequence:CCGGACAACACTGCCAGACGAAATTCTCGAGAATTTCGTCTGGCAGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005420.2-472s21c1
Sequence:CCGGAGGATTGTAAGATAATCTATCCTCGAGGATAGATTATCTTACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks