EMAIL THIS PAGE TO A FRIEND

SULT2A1

sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1

Synonyms: DHEA-ST DHEAS HST ST2 ST2A1 ST2A3 STD hSTa
UniProtKB ID: Q06520
Gene ID:
Human(6822) Summary: This gene encodes a member of the sulfotransferase family. Sulfotransferases aid in the metabolism of drugs and endogenous compounds by converting these substances into more hydrophilic water-soluble sulfate conjugates that can be easily excreted. This protein catalyzes the sulfation of steroids and bile acids in the liver and adrenal glands, and may have a role in the inherited adrenal androgen excess in women with polycystic ovary syndrome. [provided by RefSeq, Mar 2010]
Mouse(20859) sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Rat(24912) sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Horse(100050477) sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
naked mole-rat(101704327) sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Domestic Rabbit(100008598) sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
cow(533560) sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1729 Human SULT2A1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013251 MISSION® esiRNA esiRNA targeting human SULT2A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003167 Rosetta Predictions human pricing
NM_133616 Rosetta Predictions rat pricing
XM_574371 Rosetta Predictions rat pricing
NM_001111296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335177 predicted 727
2 SASI_Hs01_00109513 predicted 697
3 SASI_Hs01_00109514 predicted 335
4 SASI_Hs01_00109515 predicted 615
5 SASI_Hs01_00109516 predicted 683
6 SASI_Hs01_00109517 predicted 541
7 SASI_Hs01_00109518 predicted 659
8 SASI_Hs01_00109519 predicted 762
9 SASI_Hs01_00109520 predicted 325
10 SASI_Hs01_00109521 predicted 797
11 SASI_Hs01_00109512 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049244 predicted 411
2 SASI_Rn01_00049245 predicted 254
3 SASI_Rn01_00049246 predicted 371
4 SASI_Rn01_00049247 predicted 234
5 SASI_Rn01_00049248 predicted 258
6 SASI_Rn01_00049249 predicted 202
7 SASI_Rn01_00049250 predicted 360
8 SASI_Rn02_00267841 predicted 234
9 SASI_Rn01_00049251 predicted 724
10 SASI_Rn01_00049252 predicted 468
11 SASI_Rn01_00049253 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126597 predicted 715
2 SASI_Rn01_00126598 predicted 729
3 SASI_Rn01_00126599 predicted 724
4 SASI_Rn01_00126600 predicted 720
5 SASI_Rn01_00126601 predicted 135
6 SASI_Rn01_00126602 predicted 1073
7 SASI_Rn01_00126603 predicted 1586
8 SASI_Rn01_00126604 predicted 2027
9 SASI_Rn01_00126605 predicted 661
10 SASI_Rn01_00126606 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306742 predicted 411
2 SASI_Mm02_00306743 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003167
SULT2A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-408s21c1
Sequence:CCGGACGGAGAGTCCACGTTTATTCCTCGAGGAATAAACGTGGACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-486s21c1
Sequence:CCGGGTGATTTATCTCATGAGAAATCTCGAGATTTCTCATGAGATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-701s1c1
Sequence:CCGGCCCGAAGAACTGAACTTAATTCTCGAGAATTAAGTTCAGTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-785s1c1
Sequence:CCGGGTTGATTATGTAGTGGACAAACTCGAGTTTGTCCACTACATAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-563s1c1
Sequence:CCGGTCATGGTTTGACCACATTCATCTCGAGATGAATGTGGTCAAACCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-155s1c1
Sequence:CCGGGTACGTGATGAGTTCGTGATACTCGAGTATCACGAACTCATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-861s1c1
Sequence:CCGGCCCAAGCTGAAGACTTTGATACTCGAGTATCAAAGTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003167
SULT2A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-408s21c1
Sequence:CCGGACGGAGAGTCCACGTTTATTCCTCGAGGAATAAACGTGGACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-486s21c1
Sequence:CCGGGTGATTTATCTCATGAGAAATCTCGAGATTTCTCATGAGATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-701s1c1
Sequence:CCGGCCCGAAGAACTGAACTTAATTCTCGAGAATTAAGTTCAGTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-785s1c1
Sequence:CCGGGTTGATTATGTAGTGGACAAACTCGAGTTTGTCCACTACATAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-563s1c1
Sequence:CCGGTCATGGTTTGACCACATTCATCTCGAGATGAATGTGGTCAAACCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-155s1c1
Sequence:CCGGGTACGTGATGAGTTCGTGATACTCGAGTATCACGAACTCATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-861s1c1
Sequence:CCGGCCCAAGCTGAAGACTTTGATACTCGAGTATCAAAGTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003167
SULT2A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-408s21c1
Sequence:CCGGACGGAGAGTCCACGTTTATTCCTCGAGGAATAAACGTGGACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003167.3-486s21c1
Sequence:CCGGGTGATTTATCTCATGAGAAATCTCGAGATTTCTCATGAGATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-701s1c1
Sequence:CCGGCCCGAAGAACTGAACTTAATTCTCGAGAATTAAGTTCAGTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-785s1c1
Sequence:CCGGGTTGATTATGTAGTGGACAAACTCGAGTTTGTCCACTACATAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-563s1c1
Sequence:CCGGTCATGGTTTGACCACATTCATCTCGAGATGAATGTGGTCAAACCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-155s1c1
Sequence:CCGGGTACGTGATGAGTTCGTGATACTCGAGTATCACGAACTCATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003167.2-861s1c1
Sequence:CCGGCCCAAGCTGAAGACTTTGATACTCGAGTATCAAAGTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111296
SULT2A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-249s21c1
Sequence:CCGGGATCCAAACTGTGCCCATTTGCTCGAGCAAATGGGCACAGTTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-287s21c1
Sequence:CCGGTAGAGACTGATATAGGATATTCTCGAGAATATCCTATATCAGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-400s21c1
Sequence:CCGGGCGATCTATCTCGTGAGAAATCTCGAGATTTCTCACGAGATAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-838s21c1
Sequence:CCGGCAAGCTGAAGCCTTCGATAAACTCGAGTTTATCGAAGGCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-121s21c1
Sequence:CCGGTTGGAAGATATTCGTAATAAGCTCGAGCTTATTACGAATATCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111296
SULT2A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-249s21c1
Sequence:CCGGGATCCAAACTGTGCCCATTTGCTCGAGCAAATGGGCACAGTTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-287s21c1
Sequence:CCGGTAGAGACTGATATAGGATATTCTCGAGAATATCCTATATCAGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-400s21c1
Sequence:CCGGGCGATCTATCTCGTGAGAAATCTCGAGATTTCTCACGAGATAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-838s21c1
Sequence:CCGGCAAGCTGAAGCCTTCGATAAACTCGAGTTTATCGAAGGCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-121s21c1
Sequence:CCGGTTGGAAGATATTCGTAATAAGCTCGAGCTTATTACGAATATCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111296
SULT2A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-249s21c1
Sequence:CCGGGATCCAAACTGTGCCCATTTGCTCGAGCAAATGGGCACAGTTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-287s21c1
Sequence:CCGGTAGAGACTGATATAGGATATTCTCGAGAATATCCTATATCAGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-400s21c1
Sequence:CCGGGCGATCTATCTCGTGAGAAATCTCGAGATTTCTCACGAGATAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-838s21c1
Sequence:CCGGCAAGCTGAAGCCTTCGATAAACTCGAGTTTATCGAAGGCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111296.1-121s21c1
Sequence:CCGGTTGGAAGATATTCGTAATAAGCTCGAGCTTATTACGAATATCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks