EMAIL THIS PAGE TO A FRIEND

SULT2B1

sulfotransferase family, cytosolic, 2B, member 1

Synonyms: HSST2
UniProtKB ID: O00204, O00205, O75814
Gene ID:
Human(6820) Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(54200) sulfotransferase family, cytosolic, 2B, member 1
Rat(292915) sulfotransferase family, cytosolic, 2B, member 1
cow(531192) sulfotransferase family, cytosolic, 2B, member 1
sheep(101122543) sulfotransferase family, cytosolic, 2B, member 1
domestic guinea pig(100730889) sulfotransferase family, cytosolic, 2B, member 1
naked mole-rat(101723933) sulfotransferase family, cytosolic, 2B, member 1
dog(484403) sulfotransferase family, cytosolic, 2B, member 1
domestic cat(101086863) sulfotransferase family, cytosolic, 2B, member 1
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100790 Anti-SULT2B1 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100791 Anti-SULT2B1 (331-343) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2102333 Anti-SULT2B1 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, bovine, rabbit, rat, human, horse, mouse, guinea pig
western blot pricing
SAB2102334 Anti-SULT2B1 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, bovine, rabbit, rabbit
western blot pricing
HPA043539 Anti-SULT2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA041724 Anti-SULT2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105103 Anti-SULT2B1, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1300300 Anti-SULT2B1a/b (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300669 Anti-SULT2B1a/b (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1305980 ANTI-SULT2B1A/B(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1402368 Monoclonal Anti-SULT2B1, (N-terminal) antibody produced in mouse clone 2E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1730 Human SULT2B1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004605 Rosetta Predictions human pricing
NM_177973 Rosetta Predictions human pricing
NM_001039665 Rosetta Predictions rat pricing
NM_017465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035836 predicted 590
2 SASI_Hs01_00035837 predicted 884
3 SASI_Hs01_00035838 predicted 717
4 SASI_Hs01_00035839 predicted 608
5 SASI_Hs01_00035840 predicted 580
6 SASI_Hs01_00035841 predicted 578
7 SASI_Hs01_00035843 predicted 590
8 SASI_Hs01_00035845 predicted 727
9 SASI_Hs02_00337984 predicted 699
10 SASI_Hs01_00035842 predicted 878
11 SASI_Hs01_00035844 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083220 predicted 544
2 SASI_Hs01_00083221 predicted 827
3 SASI_Hs01_00083222 predicted 671
4 SASI_Hs01_00083223 predicted 558
5 SASI_Hs01_00083224 predicted 525
6 SASI_Hs01_00083225 predicted 521
7 SASI_Hs01_00083227 predicted 540
8 SASI_Hs01_00083229 predicted 676
9 SASI_Hs02_00369448 predicted 649
10 SASI_Hs01_00083226 predicted 830
11 SASI_Hs01_00083228 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117205 predicted 214
2 SASI_Rn01_00117206 predicted 248
3 SASI_Rn01_00117207 predicted 254
4 SASI_Rn01_00117208 predicted 639
5 SASI_Rn01_00117209 predicted 397
6 SASI_Rn01_00117211 predicted 922
7 SASI_Rn01_00117212 predicted 632
8 SASI_Rn01_00117213 predicted 989
9 SASI_Rn01_00117214 predicted 550
10 SASI_Rn02_00204869 predicted 631
11 SASI_Rn01_00117210 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060474 predicted 802
2 SASI_Mm01_00060477 predicted 503
3 SASI_Mm01_00060478 predicted 867
4 SASI_Mm01_00060479 predicted 804
5 SASI_Mm01_00060480 predicted 536
6 SASI_Mm01_00060481 predicted 661
7 SASI_Mm01_00060482 predicted 299
8 SASI_Mm01_00060483 predicted 664
9 SASI_Mm02_00323927 predicted 433
10 SASI_Mm02_00323928 predicted 643
11 SASI_Mm01_00060475 predicted 532
12 SASI_Mm01_00060476 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004605
VALIDATED
SULT2B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 2B, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004605.2-694s21c1
Sequence:CCGGGCTCCTGGTTCGACCACATTACTCGAGTAATGTGGTCGAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-317s21c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-362s21c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-206s21c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-317s1c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-749s1c1
Sequence:CCGGCCTATTTATCACCTACGAGGACTCGAGTCCTCGTAGGTGATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-362s1c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-206s1c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-599s1c1
Sequence:CCGGCCTCTATCATTACTCCAAGATCTCGAGATCTTGGAGTAATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004605
VALIDATED
SULT2B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 2B, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004605.2-694s21c1
Sequence:CCGGGCTCCTGGTTCGACCACATTACTCGAGTAATGTGGTCGAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-317s21c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-362s21c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-206s21c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-317s1c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-749s1c1
Sequence:CCGGCCTATTTATCACCTACGAGGACTCGAGTCCTCGTAGGTGATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-362s1c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-206s1c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-599s1c1
Sequence:CCGGCCTCTATCATTACTCCAAGATCTCGAGATCTTGGAGTAATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004605
VALIDATED
SULT2B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 2B, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004605.2-694s21c1
Sequence:CCGGGCTCCTGGTTCGACCACATTACTCGAGTAATGTGGTCGAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-317s21c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-362s21c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004605.2-206s21c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-317s1c1
Sequence:CCGGCGACATCTTTATCATCACCTACTCGAGTAGGTGATGATAAAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-749s1c1
Sequence:CCGGCCTATTTATCACCTACGAGGACTCGAGTCCTCGTAGGTGATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004605.2-362s1c1
Sequence:CCGGGATCGAGATCATCTGCTTAATCTCGAGATTAAGCAGATGATCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-206s1c1
Sequence:CCGGCCAGAAGTTGCCAGGTGAATACTCGAGTATTCACCTGGCAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004605.2-599s1c1
Sequence:CCGGCCTCTATCATTACTCCAAGATCTCGAGATCTTGGAGTAATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017465
SULT2B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 2B, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-539s1c1
Sequence:CCGGCTAAGATTGCTGGGCAATTAACTCGAGTTAATTGCCCAGCAATCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-538s1c1
Sequence:CCGGTCTAAGATTGCTGGGCAATTACTCGAGTAATTGCCCAGCAATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-941s1c1
Sequence:CCGGACAGTGTTTACCGAGAGCAAACTCGAGTTTGCTCTCGGTAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-144s1c1
Sequence:CCGGAGGTGAATACTTCAGATACAACTCGAGTTGTATCTGAAGTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-438s1c1
Sequence:CCGGCCCTATTGAACTCTTCACGAACTCGAGTTCGTGAAGAGTTCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017465
SULT2B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 2B, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-539s1c1
Sequence:CCGGCTAAGATTGCTGGGCAATTAACTCGAGTTAATTGCCCAGCAATCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-538s1c1
Sequence:CCGGTCTAAGATTGCTGGGCAATTACTCGAGTAATTGCCCAGCAATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-941s1c1
Sequence:CCGGACAGTGTTTACCGAGAGCAAACTCGAGTTTGCTCTCGGTAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-144s1c1
Sequence:CCGGAGGTGAATACTTCAGATACAACTCGAGTTGTATCTGAAGTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-438s1c1
Sequence:CCGGCCCTATTGAACTCTTCACGAACTCGAGTTCGTGAAGAGTTCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017465
SULT2B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 2B, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-539s1c1
Sequence:CCGGCTAAGATTGCTGGGCAATTAACTCGAGTTAATTGCCCAGCAATCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-538s1c1
Sequence:CCGGTCTAAGATTGCTGGGCAATTACTCGAGTAATTGCCCAGCAATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-941s1c1
Sequence:CCGGACAGTGTTTACCGAGAGCAAACTCGAGTTTGCTCTCGGTAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-144s1c1
Sequence:CCGGAGGTGAATACTTCAGATACAACTCGAGTTGTATCTGAAGTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017465.1-438s1c1
Sequence:CCGGCCCTATTGAACTCTTCACGAACTCGAGTTCGTGAAGAGTTCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks