EMAIL THIS PAGE TO A FRIEND

SULT4A1

sulfotransferase family 4A, member 1

Synonyms: BR-STL-1 BRSTL1 DJ388M5.3 NST SULTX3 hBR-STL-1
UniProtKB ID: Q9BR01, B2R7N3, O43728
Gene ID:
Human(25830) Summary: This gene encodes a member of the sulfotransferase family. The encoded protein is a brain-specific sulfotransferase believed to be involved in the metabolism of neurotransmitters. Polymorphisms in this gene may be associated with susceptibility to schizophrenia. [provided by RefSeq, Jul 2008]
Mouse(29859) sulfotransferase family 4A, member 1
Rat(58953) sulfotransferase family 4A, member 1
Zebrafish(678517) sulfotransferase family 4A, member 1
domestic cat(101093118) sulfotransferase family 4A, member 1
dog(609410) sulfotransferase family 4A, member 1
chicken(418232) sulfotransferase family 4A, member 1
cow(618738) sulfotransferase family 4A, member 1
sheep(101107692) sulfotransferase family 4A, member 1
Domestic Rabbit(100009444) sulfotransferase family 4A, member 1
naked mole-rat(101709824) sulfotransferase family 4A, member 1
domestic guinea pig(100726660) sulfotransferase family 4A, member 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014351 Rosetta Predictions human pricing
NM_031641 Rosetta Predictions rat pricing
NM_013873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111228 predicted 1228
2 SASI_Hs01_00111229 predicted 1241
3 SASI_Hs01_00111230 predicted 1222
4 SASI_Hs01_00111231 predicted 1443
5 SASI_Hs01_00111232 predicted 898
6 SASI_Hs01_00111233 predicted 1112
7 SASI_Hs01_00111234 predicted 902
8 SASI_Hs01_00111235 predicted 334
9 SASI_Hs01_00111236 predicted 927
10 SASI_Hs01_00111237 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064862 predicted 520
2 SASI_Rn01_00064863 predicted 861
3 SASI_Rn01_00064864 predicted 571
4 SASI_Rn02_00264948 predicted 1138
5 SASI_Rn01_00064867 predicted 260
6 SASI_Rn01_00064868 predicted 1379
7 SASI_Rn01_00064869 predicted 899
8 SASI_Rn01_00064870 predicted 1191
9 SASI_Rn01_00064871 predicted 788
10 SASI_Rn02_00264949 predicted 422
11 SASI_Rn01_00064865 predicted 835
12 SASI_Rn01_00064866 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037614 predicted 670
2 SASI_Mm01_00037615 predicted 367
3 SASI_Mm01_00037616 predicted 638
4 SASI_Mm01_00037617 predicted 969
5 SASI_Mm01_00037618 predicted 1435
6 SASI_Mm01_00037619 predicted 1218
7 SASI_Mm01_00037620 predicted 1323
8 SASI_Mm01_00037621 predicted 518
9 SASI_Mm01_00037622 predicted 703
10 SASI_Mm01_00037623 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013873
SULT4A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family 4A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013873.3-1452s1c1
Sequence:CCGGCGGAGATCAAAGAACGGGTTTCTCGAGAAACCCGTTCTTTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-642s1c1
Sequence:CCGGCGGAGGTTCATGAATGACAAACTCGAGTTTGTCATTCATGAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-559s1c1
Sequence:CCGGCCAAGGACTTGGTGGTATCTTCTCGAGAAGATACCACCAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-374s1c1
Sequence:CCGGCCCTGATGAAATCGGCCTGATCTCGAGATCAGGCCGATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-194s1c1
Sequence:CCGGCGAGTTCGAGAGCAAGTACTTCTCGAGAAGTACTTGCTCTCGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013873
SULT4A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family 4A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013873.3-1452s1c1
Sequence:CCGGCGGAGATCAAAGAACGGGTTTCTCGAGAAACCCGTTCTTTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-642s1c1
Sequence:CCGGCGGAGGTTCATGAATGACAAACTCGAGTTTGTCATTCATGAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-559s1c1
Sequence:CCGGCCAAGGACTTGGTGGTATCTTCTCGAGAAGATACCACCAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-374s1c1
Sequence:CCGGCCCTGATGAAATCGGCCTGATCTCGAGATCAGGCCGATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-194s1c1
Sequence:CCGGCGAGTTCGAGAGCAAGTACTTCTCGAGAAGTACTTGCTCTCGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013873
SULT4A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family 4A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013873.3-1452s1c1
Sequence:CCGGCGGAGATCAAAGAACGGGTTTCTCGAGAAACCCGTTCTTTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-642s1c1
Sequence:CCGGCGGAGGTTCATGAATGACAAACTCGAGTTTGTCATTCATGAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-559s1c1
Sequence:CCGGCCAAGGACTTGGTGGTATCTTCTCGAGAAGATACCACCAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-374s1c1
Sequence:CCGGCCCTGATGAAATCGGCCTGATCTCGAGATCAGGCCGATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013873.3-194s1c1
Sequence:CCGGCGAGTTCGAGAGCAAGTACTTCTCGAGAAGTACTTGCTCTCGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014351
SULT4A1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family 4A, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-586s1c1
Sequence:CCGGCCGGAGGTTTATGAATGATAACTCGAGTTATCATTCATAAACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-898s1c1
Sequence:CCGGCTTGGTGTATAAACAGAAGATCTCGAGATCTTCTGTTTATACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-562s1c1
Sequence:CCGGCCGAGGCACCTTTCAAGAATTCTCGAGAATTCTTGAAAGGTGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-466s1c1
Sequence:CCGGCAATGGAGACTCCAAGGTCATCTCGAGATGACCTTGGAGTCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-322s1c1
Sequence:CCGGCGATGAGATCGGCTTGATGAACTCGAGTTCATCAAGCCGATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014351.3-983s21c1
Sequence:CCGGACAACCTGCATGCTCACAATACTCGAGTATTGTGAGCATGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014351.3-673s21c1
Sequence:CCGGGCATGGACTCGAACGTGCTTTCTCGAGAAAGCACGTTCGAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014351
SULT4A1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family 4A, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-586s1c1
Sequence:CCGGCCGGAGGTTTATGAATGATAACTCGAGTTATCATTCATAAACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-898s1c1
Sequence:CCGGCTTGGTGTATAAACAGAAGATCTCGAGATCTTCTGTTTATACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-562s1c1
Sequence:CCGGCCGAGGCACCTTTCAAGAATTCTCGAGAATTCTTGAAAGGTGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-466s1c1
Sequence:CCGGCAATGGAGACTCCAAGGTCATCTCGAGATGACCTTGGAGTCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-322s1c1
Sequence:CCGGCGATGAGATCGGCTTGATGAACTCGAGTTCATCAAGCCGATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014351.3-983s21c1
Sequence:CCGGACAACCTGCATGCTCACAATACTCGAGTATTGTGAGCATGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014351.3-673s21c1
Sequence:CCGGGCATGGACTCGAACGTGCTTTCTCGAGAAAGCACGTTCGAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014351
SULT4A1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family 4A, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-586s1c1
Sequence:CCGGCCGGAGGTTTATGAATGATAACTCGAGTTATCATTCATAAACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-898s1c1
Sequence:CCGGCTTGGTGTATAAACAGAAGATCTCGAGATCTTCTGTTTATACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-562s1c1
Sequence:CCGGCCGAGGCACCTTTCAAGAATTCTCGAGAATTCTTGAAAGGTGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-466s1c1
Sequence:CCGGCAATGGAGACTCCAAGGTCATCTCGAGATGACCTTGGAGTCTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014351.2-322s1c1
Sequence:CCGGCGATGAGATCGGCTTGATGAACTCGAGTTCATCAAGCCGATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014351.3-983s21c1
Sequence:CCGGACAACCTGCATGCTCACAATACTCGAGTATTGTGAGCATGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014351.3-673s21c1
Sequence:CCGGGCATGGACTCGAACGTGCTTTCTCGAGAAAGCACGTTCGAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks