EMAIL THIS PAGE TO A FRIEND

SULT6B1

sulfotransferase family, cytosolic, 6B, member 1

UniProtKB ID: Q6IMI4, B2RTS7
Gene ID:
Mouse(73671) sulfotransferase family, cytosolic, 6B, member 1
Rat(503103) sulfotransferase family, cytosolic, 6B, member 1
Zebrafish(322462) sulfotransferase family, cytosolic, 6b, member 1
chicken(421473) sulfotransferase family, cytosolic, 6B, member 1
dog(483034) sulfotransferase family, cytosolic, 6B, member 1
domestic cat(101080275) sulfotransferase family, cytosolic, 6B, member 1
cow(530757) sulfotransferase family, cytosolic, 6B, member 1
sheep(101121842) sulfotransferase family, cytosolic, 6B, member 1
domestic guinea pig(100717665) sulfotransferase family, cytosolic, 6B, member 1
naked mole-rat(101724250) sulfotransferase family, cytosolic, 6B, member 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48531 Anti-SULT6B1 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, canine, human, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032377 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073101 MISSION® esiRNA esiRNA targeting mouse AC154274.1-1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032377 Rosetta Predictions human pricing
XM_001063959 Rosetta Predictions rat pricing
XM_578623 Rosetta Predictions rat pricing
XM_356960 Rosetta Predictions mouse pricing
XM_917981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060910 predicted 487
2 SASI_Hs01_00060911 predicted 598
3 SASI_Hs02_00307922 predicted 503
4 SASI_Hs01_00060912 predicted 385
5 SASI_Hs01_00060913 predicted 481
6 SASI_Hs01_00060914 predicted 390
7 SASI_Hs01_00060915 predicted 476
8 SASI_Hs01_00060916 predicted 415
9 SASI_Hs01_00060917 predicted 588
10 SASI_Hs01_00060918 predicted 491
11 SASI_Hs01_00060919 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308869 predicted 340
2 SASI_Rn02_00308870 predicted 208
3 SASI_Rn02_00308871 predicted 553
4 SASI_Rn02_00308872 predicted 828
5 SASI_Rn02_00308873 predicted 486
6 SASI_Rn02_00308874 predicted 889
7 SASI_Rn02_00308875 predicted 269
8 SASI_Rn02_00308876 predicted 211
9 SASI_Rn02_00308877 predicted 399
10 SASI_Rn02_00308878 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408136 predicted 341
2 SASI_Rn02_00408137 predicted 215
3 SASI_Rn02_00408138 predicted 555
4 SASI_Rn02_00408139 predicted 827
5 SASI_Rn02_00408140 predicted 494
6 SASI_Rn02_00408141 predicted 884
7 SASI_Rn02_00408142 predicted 856
8 SASI_Rn02_00408143 predicted 269
9 SASI_Rn02_00408144 predicted 210
10 SASI_Rn02_00408145 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277983 predicted 758
2 SASI_Mm02_00426009 predicted 567
3 SASI_Mm02_00426010 predicted 378
4 SASI_Mm01_00277985 predicted 286
5 SASI_Mm02_00426011 predicted 279
6 SASI_Mm02_00426012 predicted 502
7 SASI_Mm01_00277986 predicted 314
8 SASI_Mm02_00426013 predicted 546
9 SASI_Mm01_00277990 predicted 386
10 SASI_Mm02_00426014 predicted 354
11 SASI_Mm01_00277984 predicted 219
12 SASI_Mm01_00277987 predicted 270
13 SASI_Mm01_00277988 predicted 210
14 SASI_Mm01_00277989 predicted 227
15 SASI_Mm01_00277991 predicted 834
16 SASI_Mm01_00277992 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441590 predicted 760
2 SASI_Mm02_00441591 predicted 571
3 SASI_Mm02_00441592 predicted 373
4 SASI_Mm02_00441593 predicted 287
5 SASI_Mm02_00441594 predicted 278
6 SASI_Mm02_00441595 predicted 498
7 SASI_Mm02_00441596 predicted 312
8 SASI_Mm02_00441597 predicted 546
9 SASI_Mm02_00441598 predicted 386
10 SASI_Mm02_00441599 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032377
SULT6B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 6B, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-683s1c1
Sequence:CCGGGCAAAGGTGAAGTTGGTGATTCTCGAGAATCACCAACTTCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-559s1c1
Sequence:CCGGGCTGAGTTCTTGGGATTCTTTCTCGAGAAAGAATCCCAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-123s1c1
Sequence:CCGGCCACATTGTCAGTGAATTAATCTCGAGATTAATTCACTGACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-291s1c1
Sequence:CCGGCTTCGAGAATAAAGCCAAGATCTCGAGATCTTGGCTTTATTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-463s1c1
Sequence:CCGGGCAATCAATTGGAACAAACATCTCGAGATGTTTGTTCCAATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-304s1c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-491s1c1
Sequence:CCGGGCGACAATGTTAAGTTCATATCTCGAGATATGAACTTAACATTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-784s1c1
Sequence:CCGGGCAAAGTTGAAGTATGAATCACTCGAGTGATTCATACTTCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-259s1c1
Sequence:CCGGCACCTCCACTATGACAAATTACTCGAGTAATTTGTCATAGTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032377
SULT6B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 6B, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-683s1c1
Sequence:CCGGGCAAAGGTGAAGTTGGTGATTCTCGAGAATCACCAACTTCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-559s1c1
Sequence:CCGGGCTGAGTTCTTGGGATTCTTTCTCGAGAAAGAATCCCAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-123s1c1
Sequence:CCGGCCACATTGTCAGTGAATTAATCTCGAGATTAATTCACTGACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-291s1c1
Sequence:CCGGCTTCGAGAATAAAGCCAAGATCTCGAGATCTTGGCTTTATTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-463s1c1
Sequence:CCGGGCAATCAATTGGAACAAACATCTCGAGATGTTTGTTCCAATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-304s1c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-491s1c1
Sequence:CCGGGCGACAATGTTAAGTTCATATCTCGAGATATGAACTTAACATTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-784s1c1
Sequence:CCGGGCAAAGTTGAAGTATGAATCACTCGAGTGATTCATACTTCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-259s1c1
Sequence:CCGGCACCTCCACTATGACAAATTACTCGAGTAATTTGTCATAGTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032377
SULT6B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 6B, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-683s1c1
Sequence:CCGGGCAAAGGTGAAGTTGGTGATTCTCGAGAATCACCAACTTCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-559s1c1
Sequence:CCGGGCTGAGTTCTTGGGATTCTTTCTCGAGAAAGAATCCCAAGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-123s1c1
Sequence:CCGGCCACATTGTCAGTGAATTAATCTCGAGATTAATTCACTGACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-291s1c1
Sequence:CCGGCTTCGAGAATAAAGCCAAGATCTCGAGATCTTGGCTTTATTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-463s1c1
Sequence:CCGGGCAATCAATTGGAACAAACATCTCGAGATGTTTGTTCCAATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-304s1c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032377.1-491s1c1
Sequence:CCGGGCGACAATGTTAAGTTCATATCTCGAGATATGAACTTAACATTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-784s1c1
Sequence:CCGGGCAAAGTTGAAGTATGAATCACTCGAGTGATTCATACTTCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032377.1-259s1c1
Sequence:CCGGCACCTCCACTATGACAAATTACTCGAGTAATTTGTCATAGTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163625
SULT6B1 MISSION shRNA Bacterial Glycerol Stock
sulfotransferase family, cytosolic, 6B, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-397s21c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163625.1-1213s21c1
Sequence:CCGGCTCACTATCGGTCCAAGTATTCTCGAGAATACTTGGACCGATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-882s21c1
Sequence:CCGGGCTGAAGTATGAAGCATATTGCTCGAGCAATATGCTTCATACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-203s21c1
Sequence:CCGGCAAACTGGATTCTCCATATTGCTCGAGCAATATGGAGAATCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-62s21c1
Sequence:CCGGCAACACTTTCCCAGTTATTTCCTCGAGGAAATAACTGGGAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163625
SULT6B1 MISSION shRNA shRNA Plasmid DNA
sulfotransferase family, cytosolic, 6B, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-397s21c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163625.1-1213s21c1
Sequence:CCGGCTCACTATCGGTCCAAGTATTCTCGAGAATACTTGGACCGATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-882s21c1
Sequence:CCGGGCTGAAGTATGAAGCATATTGCTCGAGCAATATGCTTCATACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-203s21c1
Sequence:CCGGCAAACTGGATTCTCCATATTGCTCGAGCAATATGGAGAATCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-62s21c1
Sequence:CCGGCAACACTTTCCCAGTTATTTCCTCGAGGAAATAACTGGGAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163625
SULT6B1 MISSION shRNA Lentiviral Transduction Particles
sulfotransferase family, cytosolic, 6B, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-397s21c1
Sequence:CCGGGCCAAGATATTGGTGATATTTCTCGAGAAATATCACCAATATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163625.1-1213s21c1
Sequence:CCGGCTCACTATCGGTCCAAGTATTCTCGAGAATACTTGGACCGATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-882s21c1
Sequence:CCGGGCTGAAGTATGAAGCATATTGCTCGAGCAATATGCTTCATACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-203s21c1
Sequence:CCGGCAAACTGGATTCTCCATATTGCTCGAGCAATATGGAGAATCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163625.1-62s21c1
Sequence:CCGGCAACACTTTCCCAGTTATTTCCTCGAGGAAATAACTGGGAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks