EMAIL THIS PAGE TO A FRIEND

SUMF1

sulfatase modifying factor 1

Synonyms: AAPA3037 FGE
Gene ID:
Human(285362) Summary: This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(58911) sulfatase modifying factor 1
Rat(362409) sulfatase modifying factor 1
Zebrafish(553423) sulfatase modifying factor 1
domestic cat(101100288) sulfatase modifying factor 1
Horse(100052857) sulfatase modifying factor 1
dog(484681) sulfatase modifying factor 1
chicken(100859261) sulfatase modifying factor 1
naked mole-rat(101704938) sulfatase modifying factor 1
domestic guinea pig(100734272) sulfatase modifying factor 1
cow(536435) sulfatase modifying factor 1
sheep(101110003) sulfatase modifying factor 1
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182760 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182760 Rosetta Predictions human pricing
NM_001108639 Rosetta Predictions rat pricing
NM_145937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030159 predicted 488
2 SASI_Hs01_00030160 predicted 652
3 SASI_Hs01_00030161 predicted 1082
4 SASI_Hs01_00030162 predicted 1036
5 SASI_Hs01_00030163 predicted 1030
6 SASI_Hs01_00030164 predicted 465
7 SASI_Hs01_00030165 predicted 882
8 SASI_Hs01_00030166 predicted 407
9 SASI_Hs01_00030167 predicted 223
10 SASI_Hs01_00030168 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240609 predicted 627
2 SASI_Rn02_00240610 predicted 304
3 SASI_Rn02_00240611 predicted 1009
4 SASI_Rn02_00240612 predicted 496
5 SASI_Rn02_00240613 predicted 585
6 SASI_Rn02_00240614 predicted 465
7 SASI_Rn02_00240615 predicted 1188
8 SASI_Rn02_00240616 predicted 995
9 SASI_Rn02_00240617 predicted 961
10 SASI_Rn02_00240618 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023849 predicted 1020
2 SASI_Mm01_00023850 predicted 1077
3 SASI_Mm01_00023851 predicted 1012
4 SASI_Mm01_00023852 predicted 1235
5 SASI_Mm01_00023853 predicted 518
6 SASI_Mm01_00023854 predicted 784
7 SASI_Mm01_00023855 predicted 598
8 SASI_Mm02_00341390 predicted 615
9 SASI_Mm01_00023856 predicted 1158
10 SASI_Mm01_00023858 predicted 307
11 SASI_Mm01_00023857 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145937
VALIDATED
SUMF1 MISSION shRNA Bacterial Glycerol Stock
sulfatase modifying factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-2246s21c4
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-1022s21c1
Sequence:CCGGCATGTGCCATAAGTCCTATTGCTCGAGCAATAGGACTTATGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-434s21c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-1922s21c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-562s21c1
Sequence:CCGGTGCCTGTCAAGGGAGCTAATTCTCGAGAATTAGCTCCCTTGACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-592s1c1
Sequence:CCGGCACAGGTCAAATCATCCGGTTCTCGAGAACCGGATGATTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145937.1-408s1c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-2220s1c1
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145937.1-1896s1c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145937
VALIDATED
SUMF1 MISSION shRNA shRNA Plasmid DNA
sulfatase modifying factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-2246s21c4
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-1022s21c1
Sequence:CCGGCATGTGCCATAAGTCCTATTGCTCGAGCAATAGGACTTATGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-434s21c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-1922s21c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-562s21c1
Sequence:CCGGTGCCTGTCAAGGGAGCTAATTCTCGAGAATTAGCTCCCTTGACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-592s1c1
Sequence:CCGGCACAGGTCAAATCATCCGGTTCTCGAGAACCGGATGATTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145937.1-408s1c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-2220s1c1
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145937.1-1896s1c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145937
VALIDATED
SUMF1 MISSION shRNA Lentiviral Transduction Particles
sulfatase modifying factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-2246s21c4
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-1022s21c1
Sequence:CCGGCATGTGCCATAAGTCCTATTGCTCGAGCAATAGGACTTATGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-434s21c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145937.2-1922s21c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145937.2-562s21c1
Sequence:CCGGTGCCTGTCAAGGGAGCTAATTCTCGAGAATTAGCTCCCTTGACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-592s1c1
Sequence:CCGGCACAGGTCAAATCATCCGGTTCTCGAGAACCGGATGATTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145937.1-408s1c1
Sequence:CCGGGTTTGTGAACTCGACTGGCTACTCGAGTAGCCAGTCGAGTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145937.1-2220s1c1
Sequence:CCGGGCCATGAAGAAGATGGACCATCTCGAGATGGTCCATCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145937.1-1896s1c1
Sequence:CCGGGCCTTCAAAGAATGTGAAATACTCGAGTATTTCACATTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182760
VALIDATED
SUMF1 MISSION shRNA Bacterial Glycerol Stock
sulfatase modifying factor 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-473s1c1
Sequence:CCGGGAGAAGTTTGGCGACTCCTTTCTCGAGAAAGGAGTCGCCAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-338s1c1
Sequence:CCGGGATCCTCAGATAAAGCAGGATCTCGAGATCCTGCTTTATCTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1956s1c1
Sequence:CCGGGAACGTGAAATGTGCGCTAAACTCGAGTTTAGCGCACATTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-515s1c1
Sequence:CCGGGAGCAAGTGAAGACCAATATTCTCGAGAATATTGGTCTTCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-504s1c1
Sequence:CCGGGCATGTTGAGTGAGCAAGTGACTCGAGTCACTTGCTCACTCAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-371s1c1
Sequence:CCGGGCGAGGAGAGTTACTATTGATCTCGAGATCAATAGTAACTCTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182760.2-1809s1c1
Sequence:CCGGCGGTGATGGTATGCTGAAGTTCTCGAGAACTTCAGCATACCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1830s1c1
Sequence:CCGGCAGCCGTTGAACACATAGGAACTCGAGTTCCTATGTGTTCAACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1955s1c1
Sequence:CCGGCGAACGTGAAATGTGCGCTAACTCGAGTTAGCGCACATTTCACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1030s1c1
Sequence:CCGGGTGCCATAGGTCTTATTGTTACTCGAGTAACAATAAGACCTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-404s1c1
Sequence:CCGGGATGCCTATGAAGTCAGTAATCTCGAGATTACTGACTTCATAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-442s1c1
Sequence:CCGGTGTGAACTCAACTGGCTATTTCTCGAGAAATAGCCAGTTGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-878s1c1
Sequence:CCGGCCTCCCAATGGTTATGGCTTACTCGAGTAAGCCATAACCATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182760
VALIDATED
SUMF1 MISSION shRNA shRNA Plasmid DNA
sulfatase modifying factor 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-473s1c1
Sequence:CCGGGAGAAGTTTGGCGACTCCTTTCTCGAGAAAGGAGTCGCCAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-338s1c1
Sequence:CCGGGATCCTCAGATAAAGCAGGATCTCGAGATCCTGCTTTATCTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1956s1c1
Sequence:CCGGGAACGTGAAATGTGCGCTAAACTCGAGTTTAGCGCACATTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-515s1c1
Sequence:CCGGGAGCAAGTGAAGACCAATATTCTCGAGAATATTGGTCTTCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-504s1c1
Sequence:CCGGGCATGTTGAGTGAGCAAGTGACTCGAGTCACTTGCTCACTCAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-371s1c1
Sequence:CCGGGCGAGGAGAGTTACTATTGATCTCGAGATCAATAGTAACTCTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182760.2-1809s1c1
Sequence:CCGGCGGTGATGGTATGCTGAAGTTCTCGAGAACTTCAGCATACCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1830s1c1
Sequence:CCGGCAGCCGTTGAACACATAGGAACTCGAGTTCCTATGTGTTCAACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1955s1c1
Sequence:CCGGCGAACGTGAAATGTGCGCTAACTCGAGTTAGCGCACATTTCACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1030s1c1
Sequence:CCGGGTGCCATAGGTCTTATTGTTACTCGAGTAACAATAAGACCTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-404s1c1
Sequence:CCGGGATGCCTATGAAGTCAGTAATCTCGAGATTACTGACTTCATAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-442s1c1
Sequence:CCGGTGTGAACTCAACTGGCTATTTCTCGAGAAATAGCCAGTTGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-878s1c1
Sequence:CCGGCCTCCCAATGGTTATGGCTTACTCGAGTAAGCCATAACCATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182760
VALIDATED
SUMF1 MISSION shRNA Lentiviral Transduction Particles
sulfatase modifying factor 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-473s1c1
Sequence:CCGGGAGAAGTTTGGCGACTCCTTTCTCGAGAAAGGAGTCGCCAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-338s1c1
Sequence:CCGGGATCCTCAGATAAAGCAGGATCTCGAGATCCTGCTTTATCTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1956s1c1
Sequence:CCGGGAACGTGAAATGTGCGCTAAACTCGAGTTTAGCGCACATTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-515s1c1
Sequence:CCGGGAGCAAGTGAAGACCAATATTCTCGAGAATATTGGTCTTCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-504s1c1
Sequence:CCGGGCATGTTGAGTGAGCAAGTGACTCGAGTCACTTGCTCACTCAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182760.2-371s1c1
Sequence:CCGGGCGAGGAGAGTTACTATTGATCTCGAGATCAATAGTAACTCTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182760.2-1809s1c1
Sequence:CCGGCGGTGATGGTATGCTGAAGTTCTCGAGAACTTCAGCATACCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1830s1c1
Sequence:CCGGCAGCCGTTGAACACATAGGAACTCGAGTTCCTATGTGTTCAACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1955s1c1
Sequence:CCGGCGAACGTGAAATGTGCGCTAACTCGAGTTAGCGCACATTTCACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-1030s1c1
Sequence:CCGGGTGCCATAGGTCTTATTGTTACTCGAGTAACAATAAGACCTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-404s1c1
Sequence:CCGGGATGCCTATGAAGTCAGTAATCTCGAGATTACTGACTTCATAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-442s1c1
Sequence:CCGGTGTGAACTCAACTGGCTATTTCTCGAGAAATAGCCAGTTGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_182760.2-878s1c1
Sequence:CCGGCCTCCCAATGGTTATGGCTTACTCGAGTAAGCCATAACCATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks