EMAIL THIS PAGE TO A FRIEND

SUMF2

sulfatase modifying factor 2

Synonyms: pFGE
Gene ID:
Human(25870) Summary: The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(67902) sulfatase modifying factor 2
Rat(360800) sulfatase modifying factor 2
cow(509497) sulfatase modifying factor 2
Goat(100861033) sulfatase modifying factor 2
sheep(101109064) sulfatase modifying factor 2
domestic guinea pig(100720126) sulfatase modifying factor 2
naked mole-rat(101706082) sulfatase modifying factor 2
Zebrafish(449807) sulfatase modifying factor 2
chicken(417542) sulfatase modifying factor 2
domestic cat(101085769) sulfatase modifying factor 2
dog(479701) sulfatase modifying factor 2
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209301 MISSION® esiRNA esiRNA targeting mouse Sumf2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042468 Rosetta Predictions human pricing
NM_001042469 Rosetta Predictions human pricing
NM_001042470 Rosetta Predictions human pricing
NM_015411 Rosetta Predictions human pricing
NM_001025125 Rosetta Predictions rat pricing
NM_026445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309958 predicted 1030
2 SASI_Hs02_00309959 predicted 1044
3 SASI_Hs02_00309960 predicted 1083
4 SASI_Hs02_00309961 predicted 1144
5 SASI_Hs02_00309962 predicted 935
6 SASI_Hs02_00309963 predicted 1272
7 SASI_Hs02_00309964 predicted 1197
8 SASI_Hs02_00309965 predicted 1236
9 SASI_Hs02_00309966 predicted 1051
10 SASI_Hs02_00309967 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309968 predicted 974
2 SASI_Hs02_00309969 predicted 983
3 SASI_Hs02_00309970 predicted 1021
4 SASI_Hs02_00309971 predicted 1093
5 SASI_Hs02_00309972 predicted 886
6 SASI_Hs02_00309973 predicted 1214
7 SASI_Hs02_00309974 predicted 1142
8 SASI_Hs02_00309975 predicted 1181
9 SASI_Hs02_00309976 predicted 995
10 SASI_Hs02_00309977 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309978 predicted 764
2 SASI_Hs02_00309979 predicted 784
3 SASI_Hs02_00309980 predicted 823
4 SASI_Hs02_00309981 predicted 885
5 SASI_Hs02_00309982 predicted 672
6 SASI_Hs02_00309983 predicted 1007
7 SASI_Hs02_00309984 predicted 930
8 SASI_Hs02_00309985 predicted 971
9 SASI_Hs02_00309986 predicted 793
10 SASI_Hs02_00309987 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104004 predicted 1021
2 SASI_Hs01_00104005 predicted 1027
3 SASI_Hs02_00347776 predicted 1075
4 SASI_Hs02_00347777 predicted 1132
5 SASI_Hs01_00104009 predicted 927
6 SASI_Hs02_00347778 predicted 1266
7 SASI_Hs02_00347779 predicted 1188
8 SASI_Hs02_00347780 predicted 1225
9 SASI_Hs02_00347781 predicted 1040
10 SASI_Hs02_00347782 predicted 896
11 SASI_Hs01_00104001 predicted 327
12 SASI_Hs01_00104002 predicted 624
13 SASI_Hs01_00104003 predicted 227
14 SASI_Hs01_00104006 predicted 254
15 SASI_Hs01_00104007 predicted 464
16 SASI_Hs01_00104008 predicted 1199
17 SASI_Hs01_00104010 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054251 predicted 551
2 SASI_Rn01_00054252 predicted 1149
3 SASI_Rn01_00054253 predicted 241
4 SASI_Rn01_00054254 predicted 592
5 SASI_Rn01_00054255 predicted 303
6 SASI_Rn01_00054256 predicted 206
7 SASI_Rn01_00054257 predicted 1170
8 SASI_Rn01_00054258 predicted 716
9 SASI_Rn01_00054259 predicted 690
10 SASI_Rn01_00054260 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103891 predicted 998
2 SASI_Mm01_00103892 predicted 1141
3 SASI_Mm01_00103893 predicted 299
4 SASI_Mm01_00103894 predicted 968
5 SASI_Mm01_00103895 predicted 204
6 SASI_Mm01_00103896 predicted 656
7 SASI_Mm02_00330276 predicted 1237
8 SASI_Mm01_00103897 predicted 1351
9 SASI_Mm01_00103898 predicted 703
10 SASI_Mm01_00103899 predicted 926
11 SASI_Mm01_00103900 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015411
SUMF2 MISSION shRNA Bacterial Glycerol Stock
sulfatase modifying factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-323s1c1
Sequence:CCGGGAGCTTTGTCTTTGAGGACTTCTCGAGAAGTCCTCAAAGACAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-711s1c1
Sequence:CCGGCAGAACAACTACGGGCTCTATCTCGAGATAGAGCCCGTAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015411.1-1008s1c1
Sequence:CCGGCCATGTTGCAAACAGCGCAATCTCGAGATTGCGCTGTTTGCAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-218s1c1
Sequence:CCGGGACAGTGAAACCCTTTGCCATCTCGAGATGGCAAAGGGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-477s1c1
Sequence:CCGGGTGTTACACGTGAGCTGGAATCTCGAGATTCCAGCTCACGTGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-224s1c1
Sequence:CCGGGAAACCCTTTGCCATCGACATCTCGAGATGTCGATGGCAAAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-293s1c1
Sequence:CCGGGTATCGGACAGAAGCTGAGATCTCGAGATCTCAGCTTCTGTCCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1246s1c1
Sequence:CCGGGAGCACTCTGAAAGGCCATTTCTCGAGAAATGGCCTTTCAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1376s1c1
Sequence:CCGGGCTGTGGAAGGAGAATGCTTTCTCGAGAAAGCATTCTCCTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-169s1c1
Sequence:CCGGGAACAAATTCTCCAGACAGCACTCGAGTGCTGTCTGGAGAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015411
SUMF2 MISSION shRNA shRNA Plasmid DNA
sulfatase modifying factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-323s1c1
Sequence:CCGGGAGCTTTGTCTTTGAGGACTTCTCGAGAAGTCCTCAAAGACAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-711s1c1
Sequence:CCGGCAGAACAACTACGGGCTCTATCTCGAGATAGAGCCCGTAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015411.1-1008s1c1
Sequence:CCGGCCATGTTGCAAACAGCGCAATCTCGAGATTGCGCTGTTTGCAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-218s1c1
Sequence:CCGGGACAGTGAAACCCTTTGCCATCTCGAGATGGCAAAGGGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-477s1c1
Sequence:CCGGGTGTTACACGTGAGCTGGAATCTCGAGATTCCAGCTCACGTGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-224s1c1
Sequence:CCGGGAAACCCTTTGCCATCGACATCTCGAGATGTCGATGGCAAAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-293s1c1
Sequence:CCGGGTATCGGACAGAAGCTGAGATCTCGAGATCTCAGCTTCTGTCCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1246s1c1
Sequence:CCGGGAGCACTCTGAAAGGCCATTTCTCGAGAAATGGCCTTTCAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1376s1c1
Sequence:CCGGGCTGTGGAAGGAGAATGCTTTCTCGAGAAAGCATTCTCCTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-169s1c1
Sequence:CCGGGAACAAATTCTCCAGACAGCACTCGAGTGCTGTCTGGAGAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015411
SUMF2 MISSION shRNA Lentiviral Transduction Particles
sulfatase modifying factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-323s1c1
Sequence:CCGGGAGCTTTGTCTTTGAGGACTTCTCGAGAAGTCCTCAAAGACAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-711s1c1
Sequence:CCGGCAGAACAACTACGGGCTCTATCTCGAGATAGAGCCCGTAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015411.1-1008s1c1
Sequence:CCGGCCATGTTGCAAACAGCGCAATCTCGAGATTGCGCTGTTTGCAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-218s1c1
Sequence:CCGGGACAGTGAAACCCTTTGCCATCTCGAGATGGCAAAGGGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-477s1c1
Sequence:CCGGGTGTTACACGTGAGCTGGAATCTCGAGATTCCAGCTCACGTGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015411.1-224s1c1
Sequence:CCGGGAAACCCTTTGCCATCGACATCTCGAGATGTCGATGGCAAAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-293s1c1
Sequence:CCGGGTATCGGACAGAAGCTGAGATCTCGAGATCTCAGCTTCTGTCCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1246s1c1
Sequence:CCGGGAGCACTCTGAAAGGCCATTTCTCGAGAAATGGCCTTTCAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015411.1-1376s1c1
Sequence:CCGGGCTGTGGAAGGAGAATGCTTTCTCGAGAAAGCATTCTCCTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015411.1-169s1c1
Sequence:CCGGGAACAAATTCTCCAGACAGCACTCGAGTGCTGTCTGGAGAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026445
VALIDATED
SUMF2 MISSION shRNA Bacterial Glycerol Stock
sulfatase modifying factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-223s1c1
Sequence:CCGGCGACATATTTCCAGTCACCAACTCGAGTTGGTGACTGGAAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-636s1c1
Sequence:CCGGGTGACAAAGCTGAAGATGGTTCTCGAGAACCATCTTCAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-553s21c1
Sequence:CCGGGGCTTGAAGGGTCAGGTTTATCTCGAGATAAACCTGACCCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-692s21c1
Sequence:CCGGAGAACAACTACGGACTGTATGCTCGAGCATACAGTCCGTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-211s21c1
Sequence:CCGGCCCTTTGCCATCGACATATTTCTCGAGAAATATGTCGATGGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026445.2-1596s1c1
Sequence:CCGGGAAGAAGAACTGGATCTTATGCTCGAGCATAAGATCCAGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-593s21c1
Sequence:CCGGAGCCAAACCGCACCAACTTATCTCGAGATAAGTTGGTGCGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-306s21c1
Sequence:CCGGGAGCTTCGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026445
VALIDATED
SUMF2 MISSION shRNA shRNA Plasmid DNA
sulfatase modifying factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-223s1c1
Sequence:CCGGCGACATATTTCCAGTCACCAACTCGAGTTGGTGACTGGAAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-636s1c1
Sequence:CCGGGTGACAAAGCTGAAGATGGTTCTCGAGAACCATCTTCAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-553s21c1
Sequence:CCGGGGCTTGAAGGGTCAGGTTTATCTCGAGATAAACCTGACCCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-692s21c1
Sequence:CCGGAGAACAACTACGGACTGTATGCTCGAGCATACAGTCCGTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-211s21c1
Sequence:CCGGCCCTTTGCCATCGACATATTTCTCGAGAAATATGTCGATGGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026445.2-1596s1c1
Sequence:CCGGGAAGAAGAACTGGATCTTATGCTCGAGCATAAGATCCAGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-593s21c1
Sequence:CCGGAGCCAAACCGCACCAACTTATCTCGAGATAAGTTGGTGCGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-306s21c1
Sequence:CCGGGAGCTTCGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026445
VALIDATED
SUMF2 MISSION shRNA Lentiviral Transduction Particles
sulfatase modifying factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-223s1c1
Sequence:CCGGCGACATATTTCCAGTCACCAACTCGAGTTGGTGACTGGAAATATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026445.1-636s1c1
Sequence:CCGGGTGACAAAGCTGAAGATGGTTCTCGAGAACCATCTTCAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-553s21c1
Sequence:CCGGGGCTTGAAGGGTCAGGTTTATCTCGAGATAAACCTGACCCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-692s21c1
Sequence:CCGGAGAACAACTACGGACTGTATGCTCGAGCATACAGTCCGTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-211s21c1
Sequence:CCGGCCCTTTGCCATCGACATATTTCTCGAGAAATATGTCGATGGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026445.2-1596s1c1
Sequence:CCGGGAAGAAGAACTGGATCTTATGCTCGAGCATAAGATCCAGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-593s21c1
Sequence:CCGGAGCCAAACCGCACCAACTTATCTCGAGATAAGTTGGTGCGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026445.2-306s21c1
Sequence:CCGGGAGCTTCGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks