EMAIL THIS PAGE TO A FRIEND

SUMO1

small ubiquitin-like modifier 1

Synonyms: DAP1 GMP1 OFC10 PIC1 SENP2 SMT3 SMT3C SMT3H3 UBL1
Gene ID:
Human(7341) Summary: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
Mouse(22218) SMT3 suppressor of mif two 3 homolog 1 (yeast)
Rat(301442) small ubiquitin-like modifier 1
Thale Cress(828791) small ubiquitin-related modifier 1
Zebrafish(406438) SMT3 suppressor of mif two 3 homolog 1 (yeast)
domestic cat(101095673) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
dog(478874) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
chicken(373930) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
naked mole-rat(101703609) small ubiquitin-like modifier 1
domestic guinea pig(100719994) small ubiquitin-like modifier 1
cow(614967) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
Goat(100861153) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
sheep(101110738) SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N1413 NSCI ≥97% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003352 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106621 MISSION® esiRNA esiRNA human SUMO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005781 Rosetta Predictions human pricing
NM_001005782 Rosetta Predictions human pricing
NM_003352 Rosetta Predictions human pricing
NM_001009672 Rosetta Predictions rat pricing
NM_009460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048750 predicted 847
2 SASI_Hs01_00048753 predicted 728
3 SASI_Hs01_00048754 predicted 839
4 SASI_Hs01_00048755 predicted 721
5 SASI_Hs01_00048756 predicted 841
6 SASI_Hs01_00048757 predicted 726
7 SASI_Hs01_00048758 predicted 765
8 SASI_Hs01_00048751 predicted 716
9 SASI_Hs01_00048752 predicted 731
10 SASI_Hs01_00048759 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172623 predicted 208
2 SASI_Hs01_00172624 predicted 771
3 SASI_Hs01_00172621 predicted 715
4 SASI_Hs01_00172622 predicted 866
5 SASI_Hs01_00172625 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204443 predicted 288
2 SASI_Hs01_00204444 predicted 852
3 SASI_Hs01_00204445 predicted 195
4 SASI_Hs01_00204441 predicted 783
5 SASI_Hs01_00204442 predicted 940
6 SASI_Hs01_00204446 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051258 predicted 708
2 SASI_Rn01_00051259 predicted 841
3 SASI_Rn01_00051260 predicted 695
4 SASI_Rn01_00051261 predicted 843
5 SASI_Rn01_00051262 predicted 701
6 SASI_Rn01_00051263 predicted 607
7 SASI_Rn01_00051265 predicted 655
8 SASI_Rn01_00051266 predicted 837
9 SASI_Rn01_00051267 predicted 693
10 SASI_Rn02_00199708 predicted 293
11 SASI_Rn01_00051264 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076302 predicted 744
2 SASI_Mm01_00076303 predicted 232
3 SASI_Mm01_00076304 predicted 231
4 SASI_Mm01_00076305 predicted 754
5 SASI_Mm01_00076306 predicted 751
6 SASI_Mm01_00076307 predicted 224
7 SASI_Mm01_00076308 predicted 229
8 SASI_Mm01_00076309 predicted 843
9 SASI_Mm01_00076310 predicted 745
10 SASI_Mm02_00316181 predicted 789
11 SASI_Mm01_00076311 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009460
VALIDATED
SUMO1 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-641s21c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-436s21c1
Sequence:CCGGACTCGACGGTTTAGATAATTCCTCGAGGAATTATCTAAACCGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-357s21c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-395s21c1
Sequence:CCGGAGAAGATGTGATTGAAGTTTACTCGAGTAAACTTCAATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-268s21c1
Sequence:CCGGCACATCTCAAGAAACTCAAAGCTCGAGCTTTGAGTTTCTTGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-616s1c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-188s1c1
Sequence:CCGGCTCAAAGTTATTGGACAGGATCTCGAGATCCTGTCCAATAACTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-332s1c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-290s1c1
Sequence:CCGGCCAATGAATTCACTCAGGTTTCTCGAGAAACCTGAGTGAATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-148s1c1
Sequence:CCGGTGAGGACTTAGGCGATAAGAACTCGAGTTCTTATCGCCTAAGTCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009460
VALIDATED
SUMO1 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-641s21c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-436s21c1
Sequence:CCGGACTCGACGGTTTAGATAATTCCTCGAGGAATTATCTAAACCGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-357s21c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-395s21c1
Sequence:CCGGAGAAGATGTGATTGAAGTTTACTCGAGTAAACTTCAATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-268s21c1
Sequence:CCGGCACATCTCAAGAAACTCAAAGCTCGAGCTTTGAGTTTCTTGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-616s1c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-188s1c1
Sequence:CCGGCTCAAAGTTATTGGACAGGATCTCGAGATCCTGTCCAATAACTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-332s1c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-290s1c1
Sequence:CCGGCCAATGAATTCACTCAGGTTTCTCGAGAAACCTGAGTGAATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-148s1c1
Sequence:CCGGTGAGGACTTAGGCGATAAGAACTCGAGTTCTTATCGCCTAAGTCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009460
VALIDATED
SUMO1 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-641s21c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-436s21c1
Sequence:CCGGACTCGACGGTTTAGATAATTCCTCGAGGAATTATCTAAACCGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-357s21c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-395s21c1
Sequence:CCGGAGAAGATGTGATTGAAGTTTACTCGAGTAAACTTCAATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009460.2-268s21c1
Sequence:CCGGCACATCTCAAGAAACTCAAAGCTCGAGCTTTGAGTTTCTTGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-616s1c1
Sequence:CCGGGCTCCCTTAATACTGCCCTTTCTCGAGAAAGGGCAGTATTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009460.1-188s1c1
Sequence:CCGGCTCAAAGTTATTGGACAGGATCTCGAGATCCTGTCCAATAACTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-332s1c1
Sequence:CCGGGCTGATAATCATACTCCGAAACTCGAGTTTCGGAGTATGATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-290s1c1
Sequence:CCGGCCAATGAATTCACTCAGGTTTCTCGAGAAACCTGAGTGAATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009460.1-148s1c1
Sequence:CCGGTGAGGACTTAGGCGATAAGAACTCGAGTTCTTATCGCCTAAGTCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003352
VALIDATED
SUMO1 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-324s1c1
Sequence:CCGGGTTTCTCTTTGAGGGTCAGAGCTCGAGCTCTGACCCTCAAAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-207s1c1
Sequence:CCGGCAAAGTCATTGGACAGGATAGCTCGAGCTATCCTGTCCAATGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-717s1c1
Sequence:CCGGGCTTTGTTCTAGCATGTGATTCTCGAGAATCACATGCTAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-205s1c1
Sequence:CCGGCTCAAAGTCATTGGACAGGATCTCGAGATCCTGTCCAATGACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003352.3-257s1c1
Sequence:CCGGCAACACATCTCAAGAAACTCACTCGAGTGAGTTTCTTGAGATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-377s1c1
Sequence:CCGGGAATGGAGGAAGAAGATGTGACTCGAGTCACATCTTCTTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-382s1c1
Sequence:CCGGGAGGAAGAAGATGTGATTGAACTCGAGTTCAATCACATCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-640s1c1
Sequence:CCGGCCTTCATATTACCCTCTCCTTCTCGAGAAGGAGAGGGTAATATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-869s1c1
Sequence:CCGGCCTTTCCTTAACTTGAAGCTACTCGAGTAGCTTCAAGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-800s1c1
Sequence:CCGGCGACCAATGCAAGTGTTCATACTCGAGTATGAACACTTGCATTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003352
VALIDATED
SUMO1 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-324s1c1
Sequence:CCGGGTTTCTCTTTGAGGGTCAGAGCTCGAGCTCTGACCCTCAAAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-207s1c1
Sequence:CCGGCAAAGTCATTGGACAGGATAGCTCGAGCTATCCTGTCCAATGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-717s1c1
Sequence:CCGGGCTTTGTTCTAGCATGTGATTCTCGAGAATCACATGCTAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-205s1c1
Sequence:CCGGCTCAAAGTCATTGGACAGGATCTCGAGATCCTGTCCAATGACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003352.3-257s1c1
Sequence:CCGGCAACACATCTCAAGAAACTCACTCGAGTGAGTTTCTTGAGATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-377s1c1
Sequence:CCGGGAATGGAGGAAGAAGATGTGACTCGAGTCACATCTTCTTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-382s1c1
Sequence:CCGGGAGGAAGAAGATGTGATTGAACTCGAGTTCAATCACATCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-640s1c1
Sequence:CCGGCCTTCATATTACCCTCTCCTTCTCGAGAAGGAGAGGGTAATATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-869s1c1
Sequence:CCGGCCTTTCCTTAACTTGAAGCTACTCGAGTAGCTTCAAGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-800s1c1
Sequence:CCGGCGACCAATGCAAGTGTTCATACTCGAGTATGAACACTTGCATTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003352
VALIDATED
SUMO1 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-324s1c1
Sequence:CCGGGTTTCTCTTTGAGGGTCAGAGCTCGAGCTCTGACCCTCAAAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-207s1c1
Sequence:CCGGCAAAGTCATTGGACAGGATAGCTCGAGCTATCCTGTCCAATGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-717s1c1
Sequence:CCGGGCTTTGTTCTAGCATGTGATTCTCGAGAATCACATGCTAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-205s1c1
Sequence:CCGGCTCAAAGTCATTGGACAGGATCTCGAGATCCTGTCCAATGACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003352.3-257s1c1
Sequence:CCGGCAACACATCTCAAGAAACTCACTCGAGTGAGTTTCTTGAGATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003352.3-377s1c1
Sequence:CCGGGAATGGAGGAAGAAGATGTGACTCGAGTCACATCTTCTTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003352.3-382s1c1
Sequence:CCGGGAGGAAGAAGATGTGATTGAACTCGAGTTCAATCACATCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-640s1c1
Sequence:CCGGCCTTCATATTACCCTCTCCTTCTCGAGAAGGAGAGGGTAATATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-869s1c1
Sequence:CCGGCCTTTCCTTAACTTGAAGCTACTCGAGTAGCTTCAAGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003352.3-800s1c1
Sequence:CCGGCGACCAATGCAAGTGTTCATACTCGAGTATGAACACTTGCATTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks