EMAIL THIS PAGE TO A FRIEND

SUMO2

small ubiquitin-like modifier 2

Synonyms: HSMT3 SMT3B SMT3H2 SUMO3 Smt3A
UniProtKB ID: P61956, B2R4I2, P55855, Q32Q42, Q6IPZ6, Q96HK1
Gene ID:
Human(6613) Summary: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(170930) SMT3 suppressor of mif two 3 homolog 2 (yeast)
Rat(690244) small ubiquitin-like modifier 2
Thale Cress(835609) small ubiquitin-related modifier 2
chicken(770125) SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
dog(474963) SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
domestic cat(101094221) SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
cow(286807) SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
sheep(101121694) SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
domestic guinea pig(100727754) small ubiquitin-like modifier 2
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU095391 MISSION® esiRNA esiRNA targeting mouse Sumo2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005849 Rosetta Predictions human pricing
NM_006937 Rosetta Predictions human pricing
NM_133594 Rosetta Predictions rat pricing
XM_001073823 Rosetta Predictions rat pricing
NM_133354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156717 predicted 778
2 SASI_Hs01_00156718 predicted 859
3 SASI_Hs01_00156719 predicted 787
4 SASI_Hs01_00156720 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342646 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042834 predicted 266
2 SASI_Rn02_00267797 predicted 340
3 SASI_Rn02_00267798 predicted 210
4 SASI_Rn02_00267799 predicted 221
5 SASI_Rn02_00267800 predicted 214
6 SASI_Rn02_00267801 predicted 213
7 SASI_Rn02_00267802 predicted 347
8 SASI_Rn02_00267803 predicted 314
9 SASI_Rn02_00267804 predicted 229
10 SASI_Rn02_00267805 predicted 200
11 SASI_Rn01_00042835 predicted 483
12 SASI_Rn01_00042836 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344092 predicted 602
2 SASI_Rn02_00344093 predicted 462
3 SASI_Rn02_00344094 predicted 478
4 SASI_Rn02_00344095 predicted 472
5 SASI_Rn02_00344096 predicted 605
6 SASI_Rn02_00344097 predicted 576
7 SASI_Rn02_00344098 predicted 203
8 SASI_Rn02_00344099 predicted 381
9 SASI_Rn02_00344100 predicted 458
10 SASI_Rn02_00344101 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338534 predicted 461
2 SASI_Mm02_00338535 predicted 486
3 SASI_Mm02_00338536 predicted 484
4 SASI_Mm02_00338537 predicted 334
5 SASI_Mm02_00338538 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006937
VALIDATED
SUMO2 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006937.2-1097s1c1
Sequence:CCGGGCCTGCTTAGAAGTAACATTTCTCGAGAAATGTTACTTCTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-169s1c1
Sequence:CCGGGACTGAGAACAACAATCATATCTCGAGATATGATTGTTGTTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-273s1c1
Sequence:CCGGCCTATTGTGAACGACAGGGATCTCGAGATCCCTGTCGTTCACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-356s1c1
Sequence:CCGGGCACAGTTGGAAATGGAGGATCTCGAGATCCTCCATTTCCAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-301s1c1
Sequence:CCGGGAGGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-416s21c1
Sequence:CCGGACAATTGATGTGTTCCAACAGCTCGAGCTGTTGGAACACATCAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006937.3-547s21c1
Sequence:CCGGCATCCTGACTACTACCGTATACTCGAGTATACGGTAGTAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-280s21c1
Sequence:CCGGTACACCACTTAGTAAACTAATCTCGAGATTAGTTTACTAAGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-292s21c1
Sequence:CCGGTAAACTAATGAAAGCCTATTGCTCGAGCAATAGGCTTTCATTAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-353s21c1
Sequence:CCGGTTTGACGGGCAACCAATCAATCTCGAGATTGATTGGTTGCCCGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-254s21c1
Sequence:CCGGGTGGTGCAGTTTAAGATTAAGCTCGAGCTTAATCTTAAACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006937
VALIDATED
SUMO2 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006937.2-1097s1c1
Sequence:CCGGGCCTGCTTAGAAGTAACATTTCTCGAGAAATGTTACTTCTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-169s1c1
Sequence:CCGGGACTGAGAACAACAATCATATCTCGAGATATGATTGTTGTTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-273s1c1
Sequence:CCGGCCTATTGTGAACGACAGGGATCTCGAGATCCCTGTCGTTCACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-356s1c1
Sequence:CCGGGCACAGTTGGAAATGGAGGATCTCGAGATCCTCCATTTCCAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-301s1c1
Sequence:CCGGGAGGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-416s21c1
Sequence:CCGGACAATTGATGTGTTCCAACAGCTCGAGCTGTTGGAACACATCAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006937.3-547s21c1
Sequence:CCGGCATCCTGACTACTACCGTATACTCGAGTATACGGTAGTAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-280s21c1
Sequence:CCGGTACACCACTTAGTAAACTAATCTCGAGATTAGTTTACTAAGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-292s21c1
Sequence:CCGGTAAACTAATGAAAGCCTATTGCTCGAGCAATAGGCTTTCATTAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-353s21c1
Sequence:CCGGTTTGACGGGCAACCAATCAATCTCGAGATTGATTGGTTGCCCGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-254s21c1
Sequence:CCGGGTGGTGCAGTTTAAGATTAAGCTCGAGCTTAATCTTAAACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006937
VALIDATED
SUMO2 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006937.2-1097s1c1
Sequence:CCGGGCCTGCTTAGAAGTAACATTTCTCGAGAAATGTTACTTCTAAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-169s1c1
Sequence:CCGGGACTGAGAACAACAATCATATCTCGAGATATGATTGTTGTTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-273s1c1
Sequence:CCGGCCTATTGTGAACGACAGGGATCTCGAGATCCCTGTCGTTCACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-356s1c1
Sequence:CCGGGCACAGTTGGAAATGGAGGATCTCGAGATCCTCCATTTCCAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006937.2-301s1c1
Sequence:CCGGGAGGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-416s21c1
Sequence:CCGGACAATTGATGTGTTCCAACAGCTCGAGCTGTTGGAACACATCAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006937.3-547s21c1
Sequence:CCGGCATCCTGACTACTACCGTATACTCGAGTATACGGTAGTAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-280s21c1
Sequence:CCGGTACACCACTTAGTAAACTAATCTCGAGATTAGTTTACTAAGTGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-292s21c1
Sequence:CCGGTAAACTAATGAAAGCCTATTGCTCGAGCAATAGGCTTTCATTAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-353s21c1
Sequence:CCGGTTTGACGGGCAACCAATCAATCTCGAGATTGATTGGTTGCCCGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006937.3-254s21c1
Sequence:CCGGGTGGTGCAGTTTAAGATTAAGCTCGAGCTTAATCTTAAACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133354
SUMO2 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133354.1-410s1c1
Sequence:CCGGCCTGCTACTTTACTCCAGAATCTCGAGATTCTGGAGTAAAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-204s1c1
Sequence:CCGGCAGTTTAAGATTAAGAGGCATCTCGAGATGCCTCTTAATCTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-279s1c1
Sequence:CCGGAGGCAGATCAGATTCCGGTTTCTCGAGAAACCGGAATCTGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-146s1c1
Sequence:CCGGGACTGAGAACAACGATCATATCTCGAGATATGATCGTTGTTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-282s1c1
Sequence:CCGGCAGATCAGATTCCGGTTTGATCTCGAGATCAAACCGGAATCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133354
SUMO2 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133354.1-410s1c1
Sequence:CCGGCCTGCTACTTTACTCCAGAATCTCGAGATTCTGGAGTAAAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-204s1c1
Sequence:CCGGCAGTTTAAGATTAAGAGGCATCTCGAGATGCCTCTTAATCTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-279s1c1
Sequence:CCGGAGGCAGATCAGATTCCGGTTTCTCGAGAAACCGGAATCTGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-146s1c1
Sequence:CCGGGACTGAGAACAACGATCATATCTCGAGATATGATCGTTGTTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-282s1c1
Sequence:CCGGCAGATCAGATTCCGGTTTGATCTCGAGATCAAACCGGAATCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133354
SUMO2 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133354.1-410s1c1
Sequence:CCGGCCTGCTACTTTACTCCAGAATCTCGAGATTCTGGAGTAAAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-204s1c1
Sequence:CCGGCAGTTTAAGATTAAGAGGCATCTCGAGATGCCTCTTAATCTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-279s1c1
Sequence:CCGGAGGCAGATCAGATTCCGGTTTCTCGAGAAACCGGAATCTGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-146s1c1
Sequence:CCGGGACTGAGAACAACGATCATATCTCGAGATATGATCGTTGTTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133354.1-282s1c1
Sequence:CCGGCAGATCAGATTCCGGTTTGATCTCGAGATCAAACCGGAATCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks