EMAIL THIS PAGE TO A FRIEND

SUMO3

small ubiquitin-like modifier 3

Synonyms: SMT3A SMT3H1 SUMO-3 Smt3B
UniProtKB ID: P55854, B2R5X4, Q53HI9, Q6FGD4, Q9BWR4
Gene ID:
Human(6612) Summary: SUMO proteins, such as SUMO3, and ubiquitin (see MIM 191339) posttranslationally modify numerous cellular proteins and affect their metabolism and function. However, unlike ubiquitination, which targets proteins for degradation, sumoylation participates in a number of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability (Su and Li, 2002 [PubMed 12383504]
Mouse(20610) SMT3 suppressor of mif two 3 homolog 3 (yeast)
Rat(499417) small ubiquitin-like modifier 3
Thale Cress(835610) small ubiquitin-related modifier 3
domestic cat(101087771) SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)
dog(490297) small ubiquitin-related modifier 2-like
chicken(770553) SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)
domestic guinea pig(100718179) small ubiquitin-like modifier 3
naked mole-rat(101702378) small ubiquitin-like modifier 3
cow(617236) SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)
sheep(101104960) SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305060 ANTI-MOUSE SUMO3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
ELISA pricing
SAB1306672 ANTI-PAN SUMO antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305655 ANTI-PAN SUMO antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA048064 Anti-SUMO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1300523 Anti-SUMO3 (C-term P94) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300035 Anti-SUMO3 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1304709 ANTI-SUMO3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1400263 Anti-SUMO3 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2102335 Anti-SUMO3 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB3500489 Anti-SUMO3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106719 Anti-SUMO3 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rabbit
ELISA, western blot pricing
SAB4200190 Monoclonal Anti-Sumo-2/3 ~1.0 mg/mL, clone 3H12, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB1400264 Monoclonal Anti-SUMO3 antibody produced in mouse clone 4G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1300028 Monoclonal Anti-SUMO3 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1404384 Monoclonal Anti-SUMO3 antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006936 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006936 Rosetta Predictions human pricing
NM_001024295 Rosetta Predictions rat pricing
NM_019929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036606 predicted 659
2 SASI_Hs01_00036607 predicted 566
3 SASI_Hs01_00036608 predicted 696
4 SASI_Hs01_00036610 predicted 535
5 SASI_Hs01_00036612 predicted 505
6 SASI_Hs01_00036609 predicted 667
7 SASI_Hs01_00036613 predicted 525
8 SASI_Hs02_00342643 predicted 589
9 SASI_Hs02_00342644 predicted 551
10 SASI_Hs02_00342645 predicted 837
11 SASI_Hs01_00036611 predicted 638
12 SASI_Hs01_00036614 predicted 176
13 SASI_Hs01_00036615 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056395 predicted 868
2 SASI_Rn01_00056396 predicted 847
3 SASI_Rn01_00056397 predicted 867
4 SASI_Rn01_00056398 predicted 663
5 SASI_Rn01_00056399 predicted 742
6 SASI_Rn01_00056400 predicted 194
7 SASI_Rn01_00056401 predicted 447
8 SASI_Rn01_00056402 predicted 382
9 SASI_Rn02_00202485 predicted 490
10 SASI_Rn02_00202486 predicted 487
11 SASI_Rn01_00056394 predicted 251
12 SASI_Rn01_00056403 predicted 152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168490 predicted 881
2 SASI_Mm02_00325208 predicted 200
3 SASI_Mm01_00168489 predicted 550
4 SASI_Mm01_00168491 predicted 909
5 SASI_Mm01_00168492 predicted 403
6 SASI_Mm02_00325209 predicted 117
7 SASI_Mm01_00168494 predicted 264
8 SASI_Mm02_00325210 predicted 254
9 SASI_Mm01_00168497 predicted 319
10 SASI_Mm02_00325211 predicted 422
11 SASI_Mm01_00168493 predicted 471
12 SASI_Mm01_00168495 predicted 774
13 SASI_Mm01_00168496 predicted 466
14 SASI_Mm01_00168498 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006936
SUMO3 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-398s21c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006936.2-1253s21c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-242s21c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-200s21c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006936.1-1187s1c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-127s1c1
Sequence:CCGGGACAGAGAATGACCACATCAACTCGAGTTGATGTGGTCATTCTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-133s1c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-175s1c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-331s1c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006936
SUMO3 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-398s21c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006936.2-1253s21c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-242s21c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-200s21c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006936.1-1187s1c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-127s1c1
Sequence:CCGGGACAGAGAATGACCACATCAACTCGAGTTGATGTGGTCATTCTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-133s1c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-175s1c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-331s1c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006936
SUMO3 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-398s21c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006936.2-1253s21c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-242s21c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006936.2-200s21c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006936.1-1187s1c1
Sequence:CCGGCCCACATTTCTCATTTGGTAACTCGAGTTACCAAATGAGAAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-127s1c1
Sequence:CCGGGACAGAGAATGACCACATCAACTCGAGTTGATGTGGTCATTCTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-133s1c1
Sequence:CCGGGAATGACCACATCAACCTGAACTCGAGTTCAGGTTGATGTGGTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-175s1c1
Sequence:CCGGCGTGGTGCAGTTCAAGATCAACTCGAGTTGATCTTGAACTGCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006936.1-331s1c1
Sequence:CCGGCGAGGACACCATCGACGTGTTCTCGAGAACACGTCGATGGTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019929
VALIDATED
SUMO3 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019929.3-1269s21c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-198s21c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-117s21c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-264s21c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-1233s1c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-81s1c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-228s1c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-162s1c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019929.1-362s1c1
Sequence:CCGGGTTGTCCTGACCTGTGCTATTCTCGAGAATAGCACAGGTCAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019929
VALIDATED
SUMO3 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019929.3-1269s21c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-198s21c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-117s21c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-264s21c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-1233s1c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-81s1c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-228s1c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-162s1c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019929.1-362s1c1
Sequence:CCGGGTTGTCCTGACCTGTGCTATTCTCGAGAATAGCACAGGTCAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019929
VALIDATED
SUMO3 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019929.3-1269s21c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-198s21c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-117s21c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019929.3-264s21c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-1233s1c1
Sequence:CCGGGCTTTCCAAGTGTGTATTAAACTCGAGTTTAATACACACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-81s1c1
Sequence:CCGGGAAGACAGAGAATGACCACATCTCGAGATGTGGTCATTCTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-228s1c1
Sequence:CCGGCCGGTTTGATGGACAACCAATCTCGAGATTGGTTGTCCATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019929.1-162s1c1
Sequence:CCGGCCCACTGAGCAAGCTGATGAACTCGAGTTCATCAGCTTGCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019929.1-362s1c1
Sequence:CCGGGTTGTCCTGACCTGTGCTATTCTCGAGAATAGCACAGGTCAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks