EMAIL THIS PAGE TO A FRIEND

SUMO4

small ubiquitin-like modifier 4

Synonyms: IDDM5 SMT3H4 SUMO-4 dJ281H8.4
Species: Human SUMO4(387082)
UniProtKB ID: Q6EEV6, A1L3W5
Gene ID:
Human(387082) Summary: This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism. [provided by RefSeq, Jul 2008]
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002255 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129181 MISSION® esiRNA esiRNA human SUMO4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002255 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111679 predicted 207
2 SASI_Hs01_00111680 predicted 221
3 SASI_Hs01_00111681 predicted 297
4 SASI_Hs01_00111682 predicted 288
5 SASI_Hs01_00111678 predicted 361
6 SASI_Hs01_00111683 predicted 221
7 SASI_Hs02_00304146 predicted 492
8 SASI_Hs02_00304147 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002255
VALIDATED
SUMO4 MISSION shRNA Bacterial Glycerol Stock
small ubiquitin-like modifier 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-239s1c1
Sequence:CCGGGAACAGACAAACCTGCACAGTCTCGAGACTGTGCAGGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-192s1c1
Sequence:CCGGGTCAGTGAAGCAGATCAGATTCTCGAGAATCTGATCTGCTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-198s1c1
Sequence:CCGGGAAGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-202s1c1
Sequence:CCGGCAGATCAGATTCCGATTTGGTCTCGAGACCAAATCGGAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-225s1c1
Sequence:CCGGGCAACCAATCAGTGGAACAGACTCGAGTCTGTTCCACTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-246s1c1
Sequence:CCGGCAAACCTGCACAGTTGGAAATCTCGAGATTTCCAACTGTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-397s1c1
Sequence:CCGGGCAATTTGGTTCCACCACATTCTCGAGAATGTGGTGGAACCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-531s1c1
Sequence:CCGGCAAACAGCCAATGGTATGTTTCTCGAGAAACATACCATTGGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-523s21c1
Sequence:CCGGCTTCAAACCAAACAGCCAATGCTCGAGCATTGGCTGTTTGGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-479s21c1
Sequence:CCGGTACATGAAGTAACTGGTATGTCTCGAGACATACCAGTTACTTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-228s21c1
Sequence:CCGGACCAATCAGTGGAACAGACAACTCGAGTTGTCTGTTCCACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-292s21c1
Sequence:CCGGTTTCAACAGCCTACGGGAGGTCTCGAGACCTCCCGTAGGCTGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-370s21c1
Sequence:CCGGGATTACTGCATTCTCAATTAGCTCGAGCTAATTGAGAATGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002255
VALIDATED
SUMO4 MISSION shRNA shRNA Plasmid DNA
small ubiquitin-like modifier 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-239s1c1
Sequence:CCGGGAACAGACAAACCTGCACAGTCTCGAGACTGTGCAGGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-192s1c1
Sequence:CCGGGTCAGTGAAGCAGATCAGATTCTCGAGAATCTGATCTGCTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-198s1c1
Sequence:CCGGGAAGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-202s1c1
Sequence:CCGGCAGATCAGATTCCGATTTGGTCTCGAGACCAAATCGGAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-225s1c1
Sequence:CCGGGCAACCAATCAGTGGAACAGACTCGAGTCTGTTCCACTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-246s1c1
Sequence:CCGGCAAACCTGCACAGTTGGAAATCTCGAGATTTCCAACTGTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-397s1c1
Sequence:CCGGGCAATTTGGTTCCACCACATTCTCGAGAATGTGGTGGAACCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-531s1c1
Sequence:CCGGCAAACAGCCAATGGTATGTTTCTCGAGAAACATACCATTGGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-523s21c1
Sequence:CCGGCTTCAAACCAAACAGCCAATGCTCGAGCATTGGCTGTTTGGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-479s21c1
Sequence:CCGGTACATGAAGTAACTGGTATGTCTCGAGACATACCAGTTACTTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-228s21c1
Sequence:CCGGACCAATCAGTGGAACAGACAACTCGAGTTGTCTGTTCCACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-292s21c1
Sequence:CCGGTTTCAACAGCCTACGGGAGGTCTCGAGACCTCCCGTAGGCTGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-370s21c1
Sequence:CCGGGATTACTGCATTCTCAATTAGCTCGAGCTAATTGAGAATGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002255
VALIDATED
SUMO4 MISSION shRNA Lentiviral Transduction Particles
small ubiquitin-like modifier 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-239s1c1
Sequence:CCGGGAACAGACAAACCTGCACAGTCTCGAGACTGTGCAGGTTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-192s1c1
Sequence:CCGGGTCAGTGAAGCAGATCAGATTCTCGAGAATCTGATCTGCTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-198s1c1
Sequence:CCGGGAAGCAGATCAGATTCCGATTCTCGAGAATCGGAATCTGATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-202s1c1
Sequence:CCGGCAGATCAGATTCCGATTTGGTCTCGAGACCAAATCGGAATCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002255.1-225s1c1
Sequence:CCGGGCAACCAATCAGTGGAACAGACTCGAGTCTGTTCCACTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002255.1-246s1c1
Sequence:CCGGCAAACCTGCACAGTTGGAAATCTCGAGATTTCCAACTGTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-397s1c1
Sequence:CCGGGCAATTTGGTTCCACCACATTCTCGAGAATGTGGTGGAACCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002255.1-531s1c1
Sequence:CCGGCAAACAGCCAATGGTATGTTTCTCGAGAAACATACCATTGGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-523s21c1
Sequence:CCGGCTTCAAACCAAACAGCCAATGCTCGAGCATTGGCTGTTTGGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-479s21c1
Sequence:CCGGTACATGAAGTAACTGGTATGTCTCGAGACATACCAGTTACTTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-228s21c1
Sequence:CCGGACCAATCAGTGGAACAGACAACTCGAGTTGTCTGTTCCACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002255.1-292s21c1
Sequence:CCGGTTTCAACAGCCTACGGGAGGTCTCGAGACCTCCCGTAGGCTGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002255.1-370s21c1
Sequence:CCGGGATTACTGCATTCTCAATTAGCTCGAGCTAATTGAGAATGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks