EMAIL THIS PAGE TO A FRIEND

SUN1

Sad1 and UNC84 domain containing 1

Synonyms: UNC84A
Gene ID:
Human(23353) Summary: This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
Mouse(77053) Sad1 and UNC84 domain containing 1
Rat(360773) Sad1 and UNC84 domain containing 1
Thale Cress(830381) SAD1/UNC-84 domain protein 1
Zebrafish(553188) Sad1 and UNC84 domain containing 1
Horse(100054172) Sad1 and UNC84 domain containing 1
domestic cat(101087800) Sad1 and UNC84 domain containing 1
dog(480806) Sad1 and UNC84 domain containing 1
chicken(416449) Sad1 and UNC84 domain containing 1
cow(100847692) Sad1 and UNC84 domain containing 1
sheep(101115676) Sad1 and UNC84 domain containing 1
naked mole-rat(101697558) Sad1 and UNC84 domain containing 1
domestic guinea pig(100735096) Sad1 and UNC84 domain containing 1
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001130965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_379766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379766 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025154 Rosetta Predictions human pricing
NM_001007147 Rosetta Predictions rat pricing
NM_024451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032809 predicted 1332
2 SASI_Hs01_00032810 predicted 2295
3 SASI_Hs01_00032811 predicted 1142
4 SASI_Hs01_00032812 predicted 1971
5 SASI_Hs01_00032813 predicted 1873
6 SASI_Hs01_00032814 predicted 1761
7 SASI_Hs01_00032815 predicted 888
8 SASI_Hs01_00032816 predicted 2186
9 SASI_Hs01_00032817 predicted 1357
10 SASI_Hs01_00032818 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070648 predicted 798
2 SASI_Rn01_00070649 predicted 2011
3 SASI_Rn01_00070651 predicted 1240
4 SASI_Rn01_00070652 predicted 1288
5 SASI_Rn01_00070653 predicted 1152
6 SASI_Rn02_00198623 predicted 1753
7 SASI_Rn01_00070654 predicted 1012
8 SASI_Rn01_00070655 predicted 810
9 SASI_Rn01_00070656 predicted 483
10 SASI_Rn02_00198624 predicted 1647
11 SASI_Rn01_00070647 predicted 333
12 SASI_Rn01_00070650 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100628 predicted 1696
2 SASI_Mm01_00100629 predicted 873
3 SASI_Mm02_00327803 predicted 827
4 SASI_Mm01_00100630 predicted 2426
5 SASI_Mm01_00100631 predicted 2558
6 SASI_Mm01_00100632 predicted 768
7 SASI_Mm01_00100633 predicted 2529
8 SASI_Mm01_00100634 predicted 463
9 SASI_Mm01_00100635 predicted 892
10 SASI_Mm01_00100636 predicted 1524
11 SASI_Mm01_00100637 predicted 1264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024451
VALIDATED
SUN1 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024451.1-3157s21c2
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-1820s21c2
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-259s21c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-2114s21c2
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-259s1c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-257s1c1
Sequence:CCGGCCAGGCTATTGATTCGCACATCTCGAGATGTGCGAATCAATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-2114s1c1
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-1820s1c1
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-3157s1c1
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024451
VALIDATED
SUN1 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024451.1-3157s21c2
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-1820s21c2
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-259s21c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-2114s21c2
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-259s1c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-257s1c1
Sequence:CCGGCCAGGCTATTGATTCGCACATCTCGAGATGTGCGAATCAATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-2114s1c1
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-1820s1c1
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-3157s1c1
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024451
VALIDATED
SUN1 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024451.1-3157s21c2
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-1820s21c2
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-259s21c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024451.1-2114s21c2
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-259s1c1
Sequence:CCGGAGGCTATTGATTCGCACATTACTCGAGTAATGTGCGAATCAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-257s1c1
Sequence:CCGGCCAGGCTATTGATTCGCACATCTCGAGATGTGCGAATCAATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-2114s1c1
Sequence:CCGGGCAGAATATCACACACCACATCTCGAGATGTGGTGTGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-1820s1c1
Sequence:CCGGGCTGGAAGAAACCAAGCTGAACTCGAGTTCAGCTTGGTTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024451.1-3157s1c1
Sequence:CCGGCCCACGTTTCTTTCAGGGAAACTCGAGTTTCCCTGAAAGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130965
SUN1 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000297312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130965.1-2502s21c1
Sequence:CCGGTTCATGGACGAGGGCATATACCTCGAGGTATATGCCCTCGTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1442s21c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-2339s21c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1965s21c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130965
SUN1 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000297312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130965.1-2502s21c1
Sequence:CCGGTTCATGGACGAGGGCATATACCTCGAGGTATATGCCCTCGTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1442s21c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-2339s21c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1965s21c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130965
SUN1 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000297312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130965.1-2502s21c1
Sequence:CCGGTTCATGGACGAGGGCATATACCTCGAGGTATATGCCCTCGTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1442s21c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-2339s21c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130965.1-1965s21c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379766
VALIDATED
SUN1 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-289s1c1
Sequence:CCGGGAGCACAAATTGGACCCTGTACTCGAGTACAGGGTCCAATTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-1930s1c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-872s1c1
Sequence:CCGGCCAGATACACTGCATCATCTTCTCGAGAAGATGATGCAGTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-2169s1c1
Sequence:CCGGGCAGAGGTTCTCATCACAGTTCTCGAGAACTGTGATGAGAACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-2827s1c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-2453s1c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-873s1c1
Sequence:CCGGCAGATACACTGCATCATCTTTCTCGAGAAAGATGATGCAGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379766
VALIDATED
SUN1 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-289s1c1
Sequence:CCGGGAGCACAAATTGGACCCTGTACTCGAGTACAGGGTCCAATTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-1930s1c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-872s1c1
Sequence:CCGGCCAGATACACTGCATCATCTTCTCGAGAAGATGATGCAGTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-2169s1c1
Sequence:CCGGGCAGAGGTTCTCATCACAGTTCTCGAGAACTGTGATGAGAACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-2827s1c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-2453s1c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-873s1c1
Sequence:CCGGCAGATACACTGCATCATCTTTCTCGAGAAAGATGATGCAGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379766
VALIDATED
SUN1 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-289s1c1
Sequence:CCGGGAGCACAAATTGGACCCTGTACTCGAGTACAGGGTCCAATTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-1930s1c1
Sequence:CCGGGAACTAGAACAGACCAAGCAACTCGAGTTGCTTGGTCTGTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-872s1c1
Sequence:CCGGCCAGATACACTGCATCATCTTCTCGAGAAGATGATGCAGTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379766.1-2169s1c1
Sequence:CCGGGCAGAGGTTCTCATCACAGTTCTCGAGAACTGTGATGAGAACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_379766.1-2827s1c1
Sequence:CCGGGCTTTCCAAATAGTGGAACTTCTCGAGAAGTTCCACTATTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-2453s1c1
Sequence:CCGGGCTGTTCTGAAACTTACGAAACTCGAGTTTCGTAAGTTTCAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379766.1-873s1c1
Sequence:CCGGCAGATACACTGCATCATCTTTCTCGAGAAAGATGATGCAGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks