EMAIL THIS PAGE TO A FRIEND

SUN2

Sad1 and UNC84 domain containing 2

Synonyms: UNC84B
Gene ID:
Human(25777) Summary: SUN1 (MIM 607723) and SUN2 are inner nuclear membrane (INM) proteins that play a major role in nuclear-cytoplasmic connection by formation of a 'bridge' across the nuclear envelope, known as the LINC complex, via interaction with the conserved luminal KASH domain of nesprins (e.g., SYNE1; MIM 608441) located in the outer nuclear membrane (ONM). The LINC complex provides a direct connection between the nuclear lamina and the cytoskeleton, which contributes to nuclear positioning and cellular rigidity (summary by Haque et al., 2010 [PubMed 19933576]
Mouse(223697) Sad1 and UNC84 domain containing 2
Rat(315135) Sad1 and UNC84 domain containing 2
domestic guinea pig(100734538) Sad1 and UNC84 domain containing 2
naked mole-rat(101703115) Sad1 and UNC84 domain containing 2
cow(618392) Sad1 and UNC84 domain containing 2
sheep(101106156) Sad1 and UNC84 domain containing 2
Thale Cress(820242) SAD1/UNC-84 domain-containing protein 2
chicken(418021) Sad1 and UNC84 domain containing 2
dog(481250) Sad1 and UNC84 domain containing 2
domestic cat(101096079) Sad1 and UNC84 domain containing 2
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001209 ANTI-SUN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV47148 Anti-UNC84B antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, canine, mouse, rat, horse, rabbit
western blot pricing
SAB2102653 Anti-UNC84B antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, rat, human, canine, bovine, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157751 MISSION® esiRNA esiRNA human UNC84B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015374 Rosetta Predictions human pricing
XM_001076724 Rosetta Predictions rat pricing
XM_235483 Rosetta Predictions rat pricing
NM_194342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176980 predicted 2226
2 SASI_Hs01_00176981 predicted 2149
3 SASI_Hs01_00176982 predicted 2153
4 SASI_Hs02_00347724 predicted 1244
5 SASI_Hs01_00176983 predicted 2233
6 SASI_Hs01_00176984 predicted 1761
7 SASI_Hs01_00176985 predicted 1042
8 SASI_Hs01_00176987 predicted 1763
9 SASI_Hs01_00176988 predicted 1648
10 SASI_Hs01_00176989 predicted 1031
11 SASI_Hs01_00176986 predicted 1978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354280 predicted 1649
2 SASI_Rn02_00354281 predicted 1239
3 SASI_Rn02_00354282 predicted 2422
4 SASI_Rn02_00354283 predicted 718
5 SASI_Rn02_00354284 predicted 1893
6 SASI_Rn02_00354285 predicted 882
7 SASI_Rn02_00354286 predicted 1728
8 SASI_Rn02_00354287 predicted 1891
9 SASI_Rn02_00354288 predicted 2289
10 SASI_Rn02_00354289 predicted 2044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389369 predicted 1648
2 SASI_Rn02_00389370 predicted 1235
3 SASI_Rn02_00389371 predicted 2419
4 SASI_Rn02_00389372 predicted 711
5 SASI_Rn02_00389373 predicted 1893
6 SASI_Rn02_00389374 predicted 886
7 SASI_Rn02_00389375 predicted 1730
8 SASI_Rn02_00389376 predicted 1890
9 SASI_Rn02_00389377 predicted 2297
10 SASI_Rn02_00389378 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086411 predicted 2109
2 SASI_Mm02_00350628 predicted 1703
3 SASI_Mm01_00086412 predicted 2210
4 SASI_Mm02_00350629 predicted 2273
5 SASI_Mm01_00086413 predicted 2145
6 SASI_Mm01_00086414 predicted 2320
7 SASI_Mm01_00086415 predicted 1230
8 SASI_Mm01_00086416 predicted 1954
9 SASI_Mm01_00086417 predicted 2109
10 SASI_Mm01_00086418 predicted 1598
11 SASI_Mm01_00086419 predicted 1226
12 SASI_Mm01_00086420 predicted 2277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015374
VALIDATED
SUN2 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-2233s1c1
Sequence:CCGGGCCTATTCAGACGTTTCACTTCTCGAGAAGTGAAACGTCTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1760s1c1
Sequence:CCGGCTGCAGAAAGAAGGTGTGATTCTCGAGAATCACACCTTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1318s1c1
Sequence:CCGGGCAAGACTCAGAAGACCTCTTCTCGAGAAGAGGTCTTCTGAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015374.1-2230s1c1
Sequence:CCGGCGAGCCTATTCAGACGTTTCACTCGAGTGAAACGTCTGAATAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1390s1c1
Sequence:CCGGGAAGTCAGAGTGGCAAAGCATCTCGAGATGCTTTGCCACTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-349s1c1
Sequence:CCGGGAGGAAATCCAGCAACATGAACTCGAGTTCATGTTGCTGGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2815s21c1
Sequence:CCGGTGCTTAGCTCCAGAGCAGGATCTCGAGATCCTGCTCTGGAGCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2453s21c1
Sequence:CCGGGCTCTGACTTCTAGGAGCACACTCGAGTGTGCTCCTAGAAGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2618s21c1
Sequence:CCGGGTGTATATATGTAGCATATCACTCGAGTGATATGCTACATATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015374
VALIDATED
SUN2 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-2233s1c1
Sequence:CCGGGCCTATTCAGACGTTTCACTTCTCGAGAAGTGAAACGTCTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1760s1c1
Sequence:CCGGCTGCAGAAAGAAGGTGTGATTCTCGAGAATCACACCTTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1318s1c1
Sequence:CCGGGCAAGACTCAGAAGACCTCTTCTCGAGAAGAGGTCTTCTGAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015374.1-2230s1c1
Sequence:CCGGCGAGCCTATTCAGACGTTTCACTCGAGTGAAACGTCTGAATAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1390s1c1
Sequence:CCGGGAAGTCAGAGTGGCAAAGCATCTCGAGATGCTTTGCCACTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-349s1c1
Sequence:CCGGGAGGAAATCCAGCAACATGAACTCGAGTTCATGTTGCTGGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2815s21c1
Sequence:CCGGTGCTTAGCTCCAGAGCAGGATCTCGAGATCCTGCTCTGGAGCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2453s21c1
Sequence:CCGGGCTCTGACTTCTAGGAGCACACTCGAGTGTGCTCCTAGAAGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2618s21c1
Sequence:CCGGGTGTATATATGTAGCATATCACTCGAGTGATATGCTACATATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015374
VALIDATED
SUN2 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-2233s1c1
Sequence:CCGGGCCTATTCAGACGTTTCACTTCTCGAGAAGTGAAACGTCTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1760s1c1
Sequence:CCGGCTGCAGAAAGAAGGTGTGATTCTCGAGAATCACACCTTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1318s1c1
Sequence:CCGGGCAAGACTCAGAAGACCTCTTCTCGAGAAGAGGTCTTCTGAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015374.1-2230s1c1
Sequence:CCGGCGAGCCTATTCAGACGTTTCACTCGAGTGAAACGTCTGAATAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-1390s1c1
Sequence:CCGGGAAGTCAGAGTGGCAAAGCATCTCGAGATGCTTTGCCACTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015374.1-349s1c1
Sequence:CCGGGAGGAAATCCAGCAACATGAACTCGAGTTCATGTTGCTGGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2815s21c1
Sequence:CCGGTGCTTAGCTCCAGAGCAGGATCTCGAGATCCTGCTCTGGAGCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2453s21c1
Sequence:CCGGGCTCTGACTTCTAGGAGCACACTCGAGTGTGCTCCTAGAAGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015374.1-2618s21c1
Sequence:CCGGGTGTATATATGTAGCATATCACTCGAGTGATATGCTACATATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194342
VALIDATED
SUN2 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194342.1-2274s1c1
Sequence:CCGGCCCTGAGTACACATGTATCTACTCGAGTAGATACATGTGTACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194342.1-2556s1c1
Sequence:CCGGCCAGGTGTATATATGTAGCATCTCGAGATGCTACATATATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2272s21c1
Sequence:CCGGCACCCTGAGTACACGTGTATCCTCGAGGATACACGTGTACTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-255s21c1
Sequence:CCGGTCGCTACTCTCAGGATGATAACTCGAGTTATCATCCTGAGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_194342.2-644s21c1
Sequence:CCGGTCGGATCTTCCTCAGGCTATTCTCGAGAATAGCCTGAGGAAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2190s21c1
Sequence:CCGGGCCCATCCAGACCTTCTATTTCTCGAGAAATAGAAGGTCTGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194342.2-2546s21c1
Sequence:CCGGTAGGCGCCTACCAGGTGTATACTCGAGTATACACCTGGTAGGCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194342
VALIDATED
SUN2 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194342.1-2274s1c1
Sequence:CCGGCCCTGAGTACACATGTATCTACTCGAGTAGATACATGTGTACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194342.1-2556s1c1
Sequence:CCGGCCAGGTGTATATATGTAGCATCTCGAGATGCTACATATATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2272s21c1
Sequence:CCGGCACCCTGAGTACACGTGTATCCTCGAGGATACACGTGTACTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-255s21c1
Sequence:CCGGTCGCTACTCTCAGGATGATAACTCGAGTTATCATCCTGAGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_194342.2-644s21c1
Sequence:CCGGTCGGATCTTCCTCAGGCTATTCTCGAGAATAGCCTGAGGAAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2190s21c1
Sequence:CCGGGCCCATCCAGACCTTCTATTTCTCGAGAAATAGAAGGTCTGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194342.2-2546s21c1
Sequence:CCGGTAGGCGCCTACCAGGTGTATACTCGAGTATACACCTGGTAGGCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194342
VALIDATED
SUN2 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194342.1-2274s1c1
Sequence:CCGGCCCTGAGTACACATGTATCTACTCGAGTAGATACATGTGTACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194342.1-2556s1c1
Sequence:CCGGCCAGGTGTATATATGTAGCATCTCGAGATGCTACATATATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2272s21c1
Sequence:CCGGCACCCTGAGTACACGTGTATCCTCGAGGATACACGTGTACTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-255s21c1
Sequence:CCGGTCGCTACTCTCAGGATGATAACTCGAGTTATCATCCTGAGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_194342.2-644s21c1
Sequence:CCGGTCGGATCTTCCTCAGGCTATTCTCGAGAATAGCCTGAGGAAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194342.2-2190s21c1
Sequence:CCGGGCCCATCCAGACCTTCTATTTCTCGAGAAATAGAAGGTCTGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194342.2-2546s21c1
Sequence:CCGGTAGGCGCCTACCAGGTGTATACTCGAGTATACACCTGGTAGGCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks