EMAIL THIS PAGE TO A FRIEND

SUN3

Sad1 and UNC84 domain containing 3

Synonyms: SUNC1
UniProtKB ID: Q8TAQ9, A4D2F3, D3DVM3, Q4F965, Q7Z4U8
Gene ID:
Mouse(194974) Sad1 and UNC84 domain containing 3
Rat(498412) Sad1 and UNC84 domain containing 3
domestic cat(101081714) Sad1 and UNC84 domain containing 3
dog(480765) Sad1 and UNC84 domain containing 3
cow(537130) Sad1 and UNC84 domain containing 3
sheep(101108479) Sad1 and UNC84 domain containing 3
naked mole-rat(101704408) Sad1 and UNC84 domain containing 3
domestic guinea pig(100713265) Sad1 and UNC84 domain containing 3
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008344 Anti-SUN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV54470 Anti-SUNC1 antibody produced in rabbit affinity isolated antibody canine, rat, horse, bovine, human, rabbit, mouse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001030019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001030019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001030019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022781 MISSION® esiRNA esiRNA human SUNC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030019 Rosetta Predictions human pricing
NM_152782 Rosetta Predictions human pricing
XM_001054568 Rosetta Predictions rat pricing
XM_573659 Rosetta Predictions rat pricing
NM_177576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099912 predicted 962
2 SASI_Hs01_00099913 predicted 405
3 SASI_Hs02_00307633 predicted 1188
4 SASI_Hs01_00099915 predicted 674
5 SASI_Hs01_00099916 predicted 928
6 SASI_Hs01_00099917 predicted 1076
7 SASI_Hs01_00099918 predicted 482
8 SASI_Hs01_00099919 predicted 589
9 SASI_Hs02_00307634 predicted 759
10 SASI_Hs01_00099920 predicted 912
11 SASI_Hs01_00099914 predicted 438
12 SASI_Hs01_00099921 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035195 predicted 869
2 SASI_Hs01_00035196 predicted 321
3 SASI_Hs02_00366723 predicted 1111
4 SASI_Hs01_00035198 predicted 590
5 SASI_Hs01_00035199 predicted 835
6 SASI_Hs01_00035200 predicted 997
7 SASI_Hs01_00035201 predicted 390
8 SASI_Hs01_00035202 predicted 500
9 SASI_Hs02_00366724 predicted 677
10 SASI_Hs01_00035203 predicted 827
11 SASI_Hs01_00035197 predicted 354
12 SASI_Hs01_00035204 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276303 predicted 903
2 SASI_Rn02_00276304 predicted 1386
3 SASI_Rn02_00276305 predicted 1015
4 SASI_Rn02_00276306 predicted 1478
5 SASI_Rn02_00276307 predicted 1528
6 SASI_Rn02_00276308 predicted 1106
7 SASI_Rn02_00276309 predicted 1555
8 SASI_Rn02_00276310 predicted 1458
9 SASI_Rn02_00276311 predicted 1259
10 SASI_Rn02_00276312 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400617 predicted 897
2 SASI_Rn02_00400618 predicted 1382
3 SASI_Rn02_00400619 predicted 1009
4 SASI_Rn02_00400620 predicted 1484
5 SASI_Rn02_00400621 predicted 1524
6 SASI_Rn02_00400622 predicted 1100
7 SASI_Rn02_00400623 predicted 1552
8 SASI_Rn02_00400624 predicted 1456
9 SASI_Rn02_00400625 predicted 1254
10 SASI_Rn02_00400626 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150723 predicted 893
2 SASI_Mm01_00150725 predicted 486
3 SASI_Mm01_00150726 predicted 908
4 SASI_Mm02_00347736 predicted 833
5 SASI_Mm01_00150727 predicted 950
6 SASI_Mm01_00150728 predicted 684
7 SASI_Mm01_00150729 predicted 436
8 SASI_Mm01_00150730 predicted 624
9 SASI_Mm01_00150731 predicted 689
10 SASI_Mm01_00150732 predicted 417
11 SASI_Mm01_00150724 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177576
SUN3 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177576.3-612s21c1
Sequence:CCGGTATGAGATGCCTCCGGATATGCTCGAGCATATCCGGAGGCATCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.3-797s1c1
Sequence:CCGGGTTCTCTGTCTATGGCGTTATCTCGAGATAACGCCATAGACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-498s1c1
Sequence:CCGGGTTGGCTGATTATGCCTTGAACTCGAGTTCAAGGCATAATCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-487s1c1
Sequence:CCGGGACCAAATACAGTTGGCTGATCTCGAGATCAGCCAACTGTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-453s1c1
Sequence:CCGGCTTGGTACATTATGTGCTTAACTCGAGTTAAGCACATAATGTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-331s1c1
Sequence:CCGGGATGTTCTGAAGGCGTTGCTTCTCGAGAAGCAACGCCTTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-628s1c1
Sequence:CCGGGATATGATACTTCAGCCAGATCTCGAGATCTGGCTGAAGTATCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-903s1c1
Sequence:CCGGGAATGAAGCTTCTGAATCTTTCTCGAGAAAGATTCAGAAGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177576.2-1056s1c1
Sequence:CCGGCCAGAATGTCCAAGGATGTTTCTCGAGAAACATCCTTGGACATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-838s1c1
Sequence:CCGGGAAATATTCCTAGGTCAGTTTCTCGAGAAACTGACCTAGGAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177576
SUN3 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177576.3-612s21c1
Sequence:CCGGTATGAGATGCCTCCGGATATGCTCGAGCATATCCGGAGGCATCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.3-797s1c1
Sequence:CCGGGTTCTCTGTCTATGGCGTTATCTCGAGATAACGCCATAGACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-498s1c1
Sequence:CCGGGTTGGCTGATTATGCCTTGAACTCGAGTTCAAGGCATAATCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-487s1c1
Sequence:CCGGGACCAAATACAGTTGGCTGATCTCGAGATCAGCCAACTGTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-453s1c1
Sequence:CCGGCTTGGTACATTATGTGCTTAACTCGAGTTAAGCACATAATGTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-331s1c1
Sequence:CCGGGATGTTCTGAAGGCGTTGCTTCTCGAGAAGCAACGCCTTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-628s1c1
Sequence:CCGGGATATGATACTTCAGCCAGATCTCGAGATCTGGCTGAAGTATCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-903s1c1
Sequence:CCGGGAATGAAGCTTCTGAATCTTTCTCGAGAAAGATTCAGAAGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177576.2-1056s1c1
Sequence:CCGGCCAGAATGTCCAAGGATGTTTCTCGAGAAACATCCTTGGACATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-838s1c1
Sequence:CCGGGAAATATTCCTAGGTCAGTTTCTCGAGAAACTGACCTAGGAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177576
SUN3 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177576.3-612s21c1
Sequence:CCGGTATGAGATGCCTCCGGATATGCTCGAGCATATCCGGAGGCATCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.3-797s1c1
Sequence:CCGGGTTCTCTGTCTATGGCGTTATCTCGAGATAACGCCATAGACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-498s1c1
Sequence:CCGGGTTGGCTGATTATGCCTTGAACTCGAGTTCAAGGCATAATCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-487s1c1
Sequence:CCGGGACCAAATACAGTTGGCTGATCTCGAGATCAGCCAACTGTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-453s1c1
Sequence:CCGGCTTGGTACATTATGTGCTTAACTCGAGTTAAGCACATAATGTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-331s1c1
Sequence:CCGGGATGTTCTGAAGGCGTTGCTTCTCGAGAAGCAACGCCTTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-628s1c1
Sequence:CCGGGATATGATACTTCAGCCAGATCTCGAGATCTGGCTGAAGTATCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-903s1c1
Sequence:CCGGGAATGAAGCTTCTGAATCTTTCTCGAGAAAGATTCAGAAGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177576.2-1056s1c1
Sequence:CCGGCCAGAATGTCCAAGGATGTTTCTCGAGAAACATCCTTGGACATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177576.2-838s1c1
Sequence:CCGGGAAATATTCCTAGGTCAGTTTCTCGAGAAACTGACCTAGGAATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030019
SUN3 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-471s21c1
Sequence:CCGGCCAGACTTCGTATGCCTAAAGCTCGAGCTTTAGGCATACGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-308s21c1
Sequence:CCGGACTCGATCATGGAAGATTATTCTCGAGAATAATCTTCCATGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030019.1-1274s21c1
Sequence:CCGGCCATGCCACATGTCCAGAATACTCGAGTATTCTGGACATGTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-442s21c1
Sequence:CCGGATATGGTTCAAGGCTTTATAACTCGAGTTATAAAGCCTTGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-677s21c1
Sequence:CCGGGTGTCAAACTTGGTCAATTATCTCGAGATAATTGACCAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030019
SUN3 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-471s21c1
Sequence:CCGGCCAGACTTCGTATGCCTAAAGCTCGAGCTTTAGGCATACGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-308s21c1
Sequence:CCGGACTCGATCATGGAAGATTATTCTCGAGAATAATCTTCCATGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030019.1-1274s21c1
Sequence:CCGGCCATGCCACATGTCCAGAATACTCGAGTATTCTGGACATGTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-442s21c1
Sequence:CCGGATATGGTTCAAGGCTTTATAACTCGAGTTATAAAGCCTTGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-677s21c1
Sequence:CCGGGTGTCAAACTTGGTCAATTATCTCGAGATAATTGACCAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030019
SUN3 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-471s21c1
Sequence:CCGGCCAGACTTCGTATGCCTAAAGCTCGAGCTTTAGGCATACGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-308s21c1
Sequence:CCGGACTCGATCATGGAAGATTATTCTCGAGAATAATCTTCCATGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030019.1-1274s21c1
Sequence:CCGGCCATGCCACATGTCCAGAATACTCGAGTATTCTGGACATGTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-442s21c1
Sequence:CCGGATATGGTTCAAGGCTTTATAACTCGAGTTATAAAGCCTTGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030019.1-677s21c1
Sequence:CCGGGTGTCAAACTTGGTCAATTATCTCGAGATAATTGACCAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks