EMAIL THIS PAGE TO A FRIEND

SUN5

Sad1 and UNC84 domain containing 5

Synonyms: SPAG4L TSARG4 dJ726C3.1
UniProtKB ID: Q8TC36, A6NJ82, Q5T9R0
Gene ID:
Mouse(76407) Sad1 and UNC84 domain containing 5
Rat(296289) Sad1 and UNC84 domain containing 5
domestic guinea pig(100731497) Sad1 and UNC84 domain containing 5
naked mole-rat(101724298) Sad1 and UNC84 domain containing 5
Domestic Rabbit(100358243) Sad1 and UNC84 domain containing 5
cow(514087) Sad1 and UNC84 domain containing 5
sheep(101106350) Sad1 and UNC84 domain containing 5
dog(485833) Sad1 and UNC84 domain containing 5
domestic cat(101100202) Sad1 and UNC84 domain containing 5
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080675 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058921 MISSION® esiRNA esiRNA targeting mouse Spag4l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080675 Rosetta Predictions human pricing
NM_001106530 Rosetta Predictions rat pricing
NM_029599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075144 predicted 877
2 SASI_Hs01_00075145 predicted 236
3 SASI_Hs01_00075146 predicted 290
4 SASI_Hs01_00075147 predicted 561
5 SASI_Hs01_00075149 predicted 806
6 SASI_Hs01_00075150 predicted 718
7 SASI_Hs01_00075151 predicted 709
8 SASI_Hs01_00075152 predicted 346
9 SASI_Hs02_00362441 predicted 568
10 SASI_Hs01_00075153 predicted 249
11 SASI_Hs01_00075148 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219868 predicted 242
2 SASI_Rn02_00219869 predicted 293
3 SASI_Rn02_00219870 predicted 788
4 SASI_Rn02_00219871 predicted 557
5 SASI_Rn02_00219872 predicted 263
6 SASI_Rn02_00219873 predicted 511
7 SASI_Rn02_00219874 predicted 373
8 SASI_Rn02_00219875 predicted 475
9 SASI_Rn02_00219876 predicted 778
10 SASI_Rn02_00219877 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165250 predicted 713
2 SASI_Mm01_00165251 predicted 716
3 SASI_Mm01_00165252 predicted 242
4 SASI_Mm01_00165253 predicted 470
5 SASI_Mm01_00165254 predicted 428
6 SASI_Mm01_00165255 predicted 827
7 SASI_Mm01_00165256 predicted 280
8 SASI_Mm01_00165257 predicted 874
9 SASI_Mm01_00165258 predicted 637
10 SASI_Mm01_00165259 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029599
SUN5 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-815s1c1
Sequence:CCGGCCTGTCCAACATTACACTGCACTCGAGTGCAGTGTAATGTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-882s1c1
Sequence:CCGGCCAAAGGACTTTGTCATCTATCTCGAGATAGATGACAAAGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-522s1c1
Sequence:CCGGGAAGCCATATCTGATGAGCAACTCGAGTTGCTCATCAGATATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-639s21c1
Sequence:CCGGCACACGTCAGCCACGTATAACCTCGAGGTTATACGTGGCTGACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-568s21c1
Sequence:CCGGTGATTCAAGGTGATTACATTGCTCGAGCAATGTAATCACCTTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-390s21c1
Sequence:CCGGTGGCAGGATGACAGCATAAATCTCGAGATTTATGCTGTCATCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-874s21c1
Sequence:CCGGACACCGCACCAAAGGACTTTGCTCGAGCAAAGTCCTTTGGTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-162s21c1
Sequence:CCGGGGCGTCCAAAGAAGCTATATCCTCGAGGATATAGCTTCTTTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029599
SUN5 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-815s1c1
Sequence:CCGGCCTGTCCAACATTACACTGCACTCGAGTGCAGTGTAATGTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-882s1c1
Sequence:CCGGCCAAAGGACTTTGTCATCTATCTCGAGATAGATGACAAAGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-522s1c1
Sequence:CCGGGAAGCCATATCTGATGAGCAACTCGAGTTGCTCATCAGATATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-639s21c1
Sequence:CCGGCACACGTCAGCCACGTATAACCTCGAGGTTATACGTGGCTGACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-568s21c1
Sequence:CCGGTGATTCAAGGTGATTACATTGCTCGAGCAATGTAATCACCTTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-390s21c1
Sequence:CCGGTGGCAGGATGACAGCATAAATCTCGAGATTTATGCTGTCATCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-874s21c1
Sequence:CCGGACACCGCACCAAAGGACTTTGCTCGAGCAAAGTCCTTTGGTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-162s21c1
Sequence:CCGGGGCGTCCAAAGAAGCTATATCCTCGAGGATATAGCTTCTTTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029599
SUN5 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-815s1c1
Sequence:CCGGCCTGTCCAACATTACACTGCACTCGAGTGCAGTGTAATGTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-882s1c1
Sequence:CCGGCCAAAGGACTTTGTCATCTATCTCGAGATAGATGACAAAGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029599.1-522s1c1
Sequence:CCGGGAAGCCATATCTGATGAGCAACTCGAGTTGCTCATCAGATATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-639s21c1
Sequence:CCGGCACACGTCAGCCACGTATAACCTCGAGGTTATACGTGGCTGACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-568s21c1
Sequence:CCGGTGATTCAAGGTGATTACATTGCTCGAGCAATGTAATCACCTTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-390s21c1
Sequence:CCGGTGGCAGGATGACAGCATAAATCTCGAGATTTATGCTGTCATCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-874s21c1
Sequence:CCGGACACCGCACCAAAGGACTTTGCTCGAGCAAAGTCCTTTGGTGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029599.1-162s21c1
Sequence:CCGGGGCGTCCAAAGAAGCTATATCCTCGAGGATATAGCTTCTTTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080675
SUN5 MISSION shRNA Bacterial Glycerol Stock
Sad1 and UNC84 domain containing 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-713s1c1
Sequence:CCGGGCATTGACTTTGAGCACACGTCTCGAGACGTGTGCTCAAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-491s1c1
Sequence:CCGGGCATAAATGGTCCACTGCAGACTCGAGTCTGCAGTGGACCATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-352s1c1
Sequence:CCGGGTTCTGTTTAACACGTGCAGACTCGAGTCTGCACGTGTTAAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-225s1c1
Sequence:CCGGCATGAATGACAACATCCTGTTCTCGAGAACAGGATGTTGTCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-651s1c1
Sequence:CCGGGAAGATGATACACGGAGATTACTCGAGTAATCTCCGTGTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-357s1c1
Sequence:CCGGGTTTAACACGTGCAGATGCAACTCGAGTTGCATCTGCACGTGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-484s1c1
Sequence:CCGGGATGACAGCATAAATGGTCCACTCGAGTGGACCATTTATGCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-394s1c1
Sequence:CCGGCTCATGGAGAAGACAGGCATTCTCGAGAATGCCTGTCTTCTCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-572s21c1
Sequence:CCGGGTAGCATGAACCAGCTCATTGCTCGAGCAATGAGCTGGTTCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-825s21c1
Sequence:CCGGCAACGTGACACCTGGCAATTGCTCGAGCAATTGCCAGGTGTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-686s21c1
Sequence:CCGGACTTTGCCCTGAAGTCTATAGCTCGAGCTATAGACTTCAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080675
SUN5 MISSION shRNA shRNA Plasmid DNA
Sad1 and UNC84 domain containing 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-713s1c1
Sequence:CCGGGCATTGACTTTGAGCACACGTCTCGAGACGTGTGCTCAAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-491s1c1
Sequence:CCGGGCATAAATGGTCCACTGCAGACTCGAGTCTGCAGTGGACCATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-352s1c1
Sequence:CCGGGTTCTGTTTAACACGTGCAGACTCGAGTCTGCACGTGTTAAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-225s1c1
Sequence:CCGGCATGAATGACAACATCCTGTTCTCGAGAACAGGATGTTGTCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-651s1c1
Sequence:CCGGGAAGATGATACACGGAGATTACTCGAGTAATCTCCGTGTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-357s1c1
Sequence:CCGGGTTTAACACGTGCAGATGCAACTCGAGTTGCATCTGCACGTGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-484s1c1
Sequence:CCGGGATGACAGCATAAATGGTCCACTCGAGTGGACCATTTATGCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-394s1c1
Sequence:CCGGCTCATGGAGAAGACAGGCATTCTCGAGAATGCCTGTCTTCTCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-572s21c1
Sequence:CCGGGTAGCATGAACCAGCTCATTGCTCGAGCAATGAGCTGGTTCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-825s21c1
Sequence:CCGGCAACGTGACACCTGGCAATTGCTCGAGCAATTGCCAGGTGTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-686s21c1
Sequence:CCGGACTTTGCCCTGAAGTCTATAGCTCGAGCTATAGACTTCAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080675
SUN5 MISSION shRNA Lentiviral Transduction Particles
Sad1 and UNC84 domain containing 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-713s1c1
Sequence:CCGGGCATTGACTTTGAGCACACGTCTCGAGACGTGTGCTCAAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-491s1c1
Sequence:CCGGGCATAAATGGTCCACTGCAGACTCGAGTCTGCAGTGGACCATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-352s1c1
Sequence:CCGGGTTCTGTTTAACACGTGCAGACTCGAGTCTGCACGTGTTAAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-225s1c1
Sequence:CCGGCATGAATGACAACATCCTGTTCTCGAGAACAGGATGTTGTCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-651s1c1
Sequence:CCGGGAAGATGATACACGGAGATTACTCGAGTAATCTCCGTGTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-357s1c1
Sequence:CCGGGTTTAACACGTGCAGATGCAACTCGAGTTGCATCTGCACGTGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080675.3-484s1c1
Sequence:CCGGGATGACAGCATAAATGGTCCACTCGAGTGGACCATTTATGCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080675.3-394s1c1
Sequence:CCGGCTCATGGAGAAGACAGGCATTCTCGAGAATGCCTGTCTTCTCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-572s21c1
Sequence:CCGGGTAGCATGAACCAGCTCATTGCTCGAGCAATGAGCTGGTTCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-825s21c1
Sequence:CCGGCAACGTGACACCTGGCAATTGCTCGAGCAATTGCCAGGTGTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080675.3-686s21c1
Sequence:CCGGACTTTGCCCTGAAGTCTATAGCTCGAGCTATAGACTTCAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks