EMAIL THIS PAGE TO A FRIEND

SUOX

sulfite oxidase

UniProtKB ID: P51687
Gene ID:
Human(6821) Summary: Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Mouse(211389) sulfite oxidase
Rat(81805) sulfite oxidase
Zebrafish(566675) sulfite oxidase
chicken(396278) sulfite oxidase
domestic cat(101094192) sulfite oxidase
Horse(100059135) sulfite oxidase
dog(481103) sulfite oxidase
cow(509837) sulfite oxidase
sheep(101111953) sulfite oxidase
naked mole-rat(101723542) sulfite oxidase
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000456 Rosetta Predictions human pricing
NM_001032386 Rosetta Predictions human pricing
NM_001032387 Rosetta Predictions human pricing
NM_031127 Rosetta Predictions rat pricing
NM_173733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194213 predicted 764
2 SASI_Hs01_00194214 predicted 1007
3 SASI_Hs01_00194216 predicted 555
4 SASI_Hs01_00194217 predicted 653
5 SASI_Hs02_00302584 predicted 1684
6 SASI_Hs01_00194218 predicted 851
7 SASI_Hs01_00194219 predicted 1446
8 SASI_Hs01_00194220 predicted 1253
9 SASI_Hs01_00194221 predicted 1125
10 SASI_Hs01_00194222 predicted 1830
11 SASI_Hs01_00194215 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094019 predicted 646
2 SASI_Hs01_00094020 predicted 881
3 SASI_Hs01_00094022 predicted 434
4 SASI_Hs01_00094023 predicted 525
5 SASI_Hs02_00307929 predicted 1566
6 SASI_Hs01_00094024 predicted 728
7 SASI_Hs01_00094025 predicted 1326
8 SASI_Hs01_00094026 predicted 1125
9 SASI_Hs01_00094027 predicted 1002
10 SASI_Hs01_00094028 predicted 1704
11 SASI_Hs01_00094021 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049085 predicted 531
2 SASI_Hs02_00307930 predicted 1631
3 SASI_Hs01_00049086 predicted 768
4 SASI_Hs01_00049088 predicted 320
5 SASI_Hs01_00049089 predicted 422
6 SASI_Hs02_00307931 predicted 1449
7 SASI_Hs01_00049090 predicted 615
8 SASI_Hs01_00049091 predicted 1213
9 SASI_Hs01_00049092 predicted 1019
10 SASI_Hs01_00049093 predicted 894
11 SASI_Hs01_00049087 predicted 1797
12 SASI_Hs01_00049094 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069523 predicted 1141
2 SASI_Rn01_00069524 predicted 703
3 SASI_Rn01_00069525 predicted 1523
4 SASI_Rn01_00069527 predicted 538
5 SASI_Rn01_00069528 predicted 1531
6 SASI_Rn01_00069529 predicted 1485
7 SASI_Rn01_00069530 predicted 1386
8 SASI_Rn01_00069531 predicted 460
9 SASI_Rn01_00069532 predicted 1309
10 SASI_Rn02_00264441 predicted 1273
11 SASI_Rn01_00069526 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043775 predicted 718
2 SASI_Mm01_00043776 predicted 1077
3 SASI_Mm01_00043777 predicted 1734
4 SASI_Mm01_00043778 predicted 1301
5 SASI_Mm01_00043779 predicted 826
6 SASI_Mm01_00043780 predicted 1191
7 SASI_Mm01_00043781 predicted 1541
8 SASI_Mm01_00043782 predicted 1495
9 SASI_Mm01_00043783 predicted 1288
10 SASI_Mm01_00043784 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000456
VALIDATED
SUOX MISSION shRNA Bacterial Glycerol Stock
sulfite oxidase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-369s21c1
Sequence:CCGGGCCTGCAGACTCAAGTCAATCCTCGAGGATTGACTTGAGTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2114s21c1
Sequence:CCGGCTTCCCTCTTTGGACACTATGCTCGAGCATAGTGTCCAAAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1064s21c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1855s21c1
Sequence:CCGGCTGTGGATGATGGTTACAATGCTCGAGCATTGTAACCATCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2166s21c1
Sequence:CCGGCCAGGAAGTGTGAGCTGTTACCTCGAGGTAACAGCTCACACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1003s21c1
Sequence:CCGGATCCAGACACCTATCGCTTACCTCGAGGTAAGCGATAGGTGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-2073s21c1
Sequence:CCGGGCCATACCCAAGTACACATATCTCGAGATATGTGTACTTGGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1933s21c1
Sequence:CCGGGGCATCGTGTCCATGTCTATGCTCGAGCATAGACATGGACACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-1213s21c1
Sequence:CCGGCACGGCTCTGTGATGTGTTAGCTCGAGCTAACACATCACAGAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-760s21c1
Sequence:CCGGAGTCCCATGTGCGTGAGTTACCTCGAGGTAACTCACGCACATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-406s21c1
Sequence:CCGGTTCAGGCCTGCTCCACAAATGCTCGAGCATTTGTGGAGCAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1470s1c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1984s1c1
Sequence:CCGGCCATCCATTCAGGAACTTCCTCTCGAGAGGAAGTTCCTGAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1066s1c1
Sequence:CCGGACAGAATTTGTGGACCTACATCTCGAGATGTAGGTCCACAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1539s1c1
Sequence:CCGGCTCTGAGATGACTCAGGTCAACTCGAGTTGACCTGAGTCATCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-966s1c1
Sequence:CCGGTCAGGAGTCAACACACATATACTCGAGTATATGTGTGTTGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000456
VALIDATED
SUOX MISSION shRNA shRNA Plasmid DNA
sulfite oxidase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-369s21c1
Sequence:CCGGGCCTGCAGACTCAAGTCAATCCTCGAGGATTGACTTGAGTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2114s21c1
Sequence:CCGGCTTCCCTCTTTGGACACTATGCTCGAGCATAGTGTCCAAAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1064s21c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1855s21c1
Sequence:CCGGCTGTGGATGATGGTTACAATGCTCGAGCATTGTAACCATCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2166s21c1
Sequence:CCGGCCAGGAAGTGTGAGCTGTTACCTCGAGGTAACAGCTCACACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1003s21c1
Sequence:CCGGATCCAGACACCTATCGCTTACCTCGAGGTAAGCGATAGGTGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-2073s21c1
Sequence:CCGGGCCATACCCAAGTACACATATCTCGAGATATGTGTACTTGGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1933s21c1
Sequence:CCGGGGCATCGTGTCCATGTCTATGCTCGAGCATAGACATGGACACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-1213s21c1
Sequence:CCGGCACGGCTCTGTGATGTGTTAGCTCGAGCTAACACATCACAGAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-760s21c1
Sequence:CCGGAGTCCCATGTGCGTGAGTTACCTCGAGGTAACTCACGCACATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-406s21c1
Sequence:CCGGTTCAGGCCTGCTCCACAAATGCTCGAGCATTTGTGGAGCAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1470s1c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1984s1c1
Sequence:CCGGCCATCCATTCAGGAACTTCCTCTCGAGAGGAAGTTCCTGAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1066s1c1
Sequence:CCGGACAGAATTTGTGGACCTACATCTCGAGATGTAGGTCCACAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1539s1c1
Sequence:CCGGCTCTGAGATGACTCAGGTCAACTCGAGTTGACCTGAGTCATCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-966s1c1
Sequence:CCGGTCAGGAGTCAACACACATATACTCGAGTATATGTGTGTTGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000456
VALIDATED
SUOX MISSION shRNA Lentiviral Transduction Particles
sulfite oxidase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-369s21c1
Sequence:CCGGGCCTGCAGACTCAAGTCAATCCTCGAGGATTGACTTGAGTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2114s21c1
Sequence:CCGGCTTCCCTCTTTGGACACTATGCTCGAGCATAGTGTCCAAAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1064s21c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1855s21c1
Sequence:CCGGCTGTGGATGATGGTTACAATGCTCGAGCATTGTAACCATCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000456.2-2166s21c1
Sequence:CCGGCCAGGAAGTGTGAGCTGTTACCTCGAGGTAACAGCTCACACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1003s21c1
Sequence:CCGGATCCAGACACCTATCGCTTACCTCGAGGTAAGCGATAGGTGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-2073s21c1
Sequence:CCGGGCCATACCCAAGTACACATATCTCGAGATATGTGTACTTGGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000456.2-1933s21c1
Sequence:CCGGGGCATCGTGTCCATGTCTATGCTCGAGCATAGACATGGACACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-1213s21c1
Sequence:CCGGCACGGCTCTGTGATGTGTTAGCTCGAGCTAACACATCACAGAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-760s21c1
Sequence:CCGGAGTCCCATGTGCGTGAGTTACCTCGAGGTAACTCACGCACATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000456.2-406s21c1
Sequence:CCGGTTCAGGCCTGCTCCACAAATGCTCGAGCATTTGTGGAGCAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1470s1c1
Sequence:CCGGCCTGGATGACTTGCACAACTTCTCGAGAAGTTGTGCAAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-1984s1c1
Sequence:CCGGCCATCCATTCAGGAACTTCCTCTCGAGAGGAAGTTCCTGAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1066s1c1
Sequence:CCGGACAGAATTTGTGGACCTACATCTCGAGATGTAGGTCCACAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000456.1-1539s1c1
Sequence:CCGGCTCTGAGATGACTCAGGTCAACTCGAGTTGACCTGAGTCATCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000456.1-966s1c1
Sequence:CCGGTCAGGAGTCAACACACATATACTCGAGTATATGTGTGTTGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173733
VALIDATED
SUOX MISSION shRNA Bacterial Glycerol Stock
sulfite oxidase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173733.3-1732s21c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-628s21c1
Sequence:CCGGCATCCAGCCCTGAGGATTAATCTCGAGATTAATCCTCAGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-529s21c1
Sequence:CCGGGAGTTACTGGCCGAGTATAAGCTCGAGCTTATACTCGGCCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-604s21c1
Sequence:CCGGCCTTATGCTGATGATCCTATTCTCGAGAATAGGATCATCAGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-1609s21c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-821s21c1
Sequence:CCGGTGGATGATTTGCATAAGTTTCCTCGAGGAAACTTATGCAAATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-1299s21c1
Sequence:CCGGTGTGGACTGGGACACGGTAAACTCGAGTTTACCGTGTCCCAGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-631s1c1
Sequence:CCGGCCTCCTGAACTGCTAACTGAACTCGAGTTCAGTTAGCAGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1564s1c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1285s1c1
Sequence:CCGGGCTCCATCAATTCAGGAACTACTCGAGTAGTTCCTGAATTGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-1075s1c1
Sequence:CCGGCTCCTGGCTTATGAAATGAATCTCGAGATTCATTTCATAAGCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173733.2-1687s1c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173733
VALIDATED
SUOX MISSION shRNA shRNA Plasmid DNA
sulfite oxidase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173733.3-1732s21c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-628s21c1
Sequence:CCGGCATCCAGCCCTGAGGATTAATCTCGAGATTAATCCTCAGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-529s21c1
Sequence:CCGGGAGTTACTGGCCGAGTATAAGCTCGAGCTTATACTCGGCCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-604s21c1
Sequence:CCGGCCTTATGCTGATGATCCTATTCTCGAGAATAGGATCATCAGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-1609s21c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-821s21c1
Sequence:CCGGTGGATGATTTGCATAAGTTTCCTCGAGGAAACTTATGCAAATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-1299s21c1
Sequence:CCGGTGTGGACTGGGACACGGTAAACTCGAGTTTACCGTGTCCCAGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-631s1c1
Sequence:CCGGCCTCCTGAACTGCTAACTGAACTCGAGTTCAGTTAGCAGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1564s1c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1285s1c1
Sequence:CCGGGCTCCATCAATTCAGGAACTACTCGAGTAGTTCCTGAATTGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-1075s1c1
Sequence:CCGGCTCCTGGCTTATGAAATGAATCTCGAGATTCATTTCATAAGCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173733.2-1687s1c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173733
VALIDATED
SUOX MISSION shRNA Lentiviral Transduction Particles
sulfite oxidase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173733.3-1732s21c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-628s21c1
Sequence:CCGGCATCCAGCCCTGAGGATTAATCTCGAGATTAATCCTCAGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-529s21c1
Sequence:CCGGGAGTTACTGGCCGAGTATAAGCTCGAGCTTATACTCGGCCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-604s21c1
Sequence:CCGGCCTTATGCTGATGATCCTATTCTCGAGAATAGGATCATCAGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173733.3-1609s21c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-821s21c1
Sequence:CCGGTGGATGATTTGCATAAGTTTCCTCGAGGAAACTTATGCAAATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173733.3-1299s21c1
Sequence:CCGGTGTGGACTGGGACACGGTAAACTCGAGTTTACCGTGTCCCAGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-631s1c1
Sequence:CCGGCCTCCTGAACTGCTAACTGAACTCGAGTTCAGTTAGCAGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1564s1c1
Sequence:CCGGGCTGTAGATGACAGTTACAATCTCGAGATTGTAACTGTCATCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173733.2-1285s1c1
Sequence:CCGGGCTCCATCAATTCAGGAACTACTCGAGTAGTTCCTGAATTGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173733.2-1075s1c1
Sequence:CCGGCTCCTGGCTTATGAAATGAATCTCGAGATTCATTTCATAAGCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173733.2-1687s1c1
Sequence:CCGGGCACCATTTGTACCCAAAGAACTCGAGTTCTTTGGGTACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks