EMAIL THIS PAGE TO A FRIEND

SUPT16H

suppressor of Ty 16 homolog (S. cerevisiae)

Synonyms: CDC68 FACTP140 SPT16/CDC68
UniProtKB ID: Q9Y5B9, Q6GMT8, Q6P2F1, Q6PJM1, Q9NRX0
Gene ID:
Human(11198) Summary: Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Rat(305851) suppressor of Ty 16 homolog (S. cerevisiae)
cow(514989) suppressor of Ty 16 homolog (S. cerevisiae)
sheep(101109451) suppressor of Ty 16 homolog (S. cerevisiae)
Goat(100860965) suppressor of Ty 16 homolog (S. cerevisiae)
domestic guinea pig(100718509) suppressor of Ty 16 homolog (S. cerevisiae)
naked mole-rat(101699312) suppressor of Ty 16 homolog (S. cerevisiae)
Domestic Rabbit(100353045) suppressor of Ty 16 homolog (S. cerevisiae)
Zebrafish(562348) suppressor of Ty 16 homolog
Horse(100059304) suppressor of Ty 16 homolog (S. cerevisiae)
domestic cat(101097154) suppressor of Ty 16 homolog (S. cerevisiae)
dog(612874) suppressor of Ty 16 homolog (S. cerevisiae)
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500377 Anti-FACT/SUPT16H antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412163 ANTI-SUPT16H antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412170 ANTI-SUPT16H antibody produced in mouse clone 1F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412171 ANTI-SUPT16H antibody produced in mouse clone 3G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV31526 Anti-SUPT16H antibody produced in rabbit IgG fraction of antiserum bovine, rat, rabbit, horse, human, guinea pig, pig, zebrafish, mouse, canine
western blot pricing
SAB2102336 Anti-SUPT16H antibody produced in rabbit affinity isolated antibody canine, zebrafish, human, mouse, rat, bovine, rabbit, horse
western blot pricing
HPA049787 Anti-SUPT16H antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500224 Anti-SUPT16H, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
WH0011198M1 Monoclonal Anti-SUPT16H antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1404915 Monoclonal Anti-SUPT16H antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007192 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039881 MISSION® esiRNA esiRNA human SUPT16H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007192 Rosetta Predictions human pricing
NM_001107261 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143917 predicted 1159
2 SASI_Hs01_00143919 predicted 2792
3 SASI_Hs02_00343164 predicted 3426
4 SASI_Hs02_00343165 predicted 2748
5 SASI_Hs01_00143920 predicted 3050
6 SASI_Hs01_00143921 predicted 2326
7 SASI_Hs01_00143922 predicted 839
8 SASI_Hs01_00143924 predicted 423
9 SASI_Hs01_00143925 predicted 2382
10 SASI_Hs02_00343166 predicted 487
11 SASI_Hs01_00143918 predicted 1299
12 SASI_Hs01_00143923 predicted 680
13 SASI_Hs01_00143926 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227095 predicted 2519
2 SASI_Rn02_00227096 predicted 1137
3 SASI_Rn02_00227097 predicted 340
4 SASI_Rn02_00227098 predicted 2110
5 SASI_Rn02_00227099 predicted 393
6 SASI_Rn02_00227100 predicted 1559
7 SASI_Rn02_00227101 predicted 891
8 SASI_Rn02_00227102 predicted 1757
9 SASI_Rn02_00227103 predicted 621
10 SASI_Rn02_00227104 predicted 2592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007192
VALIDATED
SUPT16H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1855s21c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2634s21c1
Sequence:CCGGTGAGCAGATGGAACGAGAAATCTCGAGATTTCTCGTTCCATCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-3952s21c1
Sequence:CCGGACTCAAGGTTCTCGGAAATTTCTCGAGAAATTTCCGAGAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1407s21c1
Sequence:CCGGCCGTGAAGGCTCCCTAGTAATCTCGAGATTACTAGGGAGCCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2193s21c1
Sequence:CCGGTCAGAATGCTTTCCGAATTATCTCGAGATAATTCGGAAAGCATTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-4315s1c1
Sequence:CCGGCCTAGAATACCCTGATGAGAACTCGAGTTCTCATCAGGGTATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-2470s1c1
Sequence:CCGGCCCTGTGATGGAGAAATGATTCTCGAGAATCATTTCTCCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007192.x-1855s1c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-1705s1c1
Sequence:CCGGCGGGCAGCATTACTTACAGAACTCGAGTTCTGTAAGTAATGCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-640s1c1
Sequence:CCGGCCTGCCATCACACTGCTAATACTCGAGTATTAGCAGTGTGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007192
VALIDATED
SUPT16H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1855s21c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2634s21c1
Sequence:CCGGTGAGCAGATGGAACGAGAAATCTCGAGATTTCTCGTTCCATCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-3952s21c1
Sequence:CCGGACTCAAGGTTCTCGGAAATTTCTCGAGAAATTTCCGAGAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1407s21c1
Sequence:CCGGCCGTGAAGGCTCCCTAGTAATCTCGAGATTACTAGGGAGCCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2193s21c1
Sequence:CCGGTCAGAATGCTTTCCGAATTATCTCGAGATAATTCGGAAAGCATTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-4315s1c1
Sequence:CCGGCCTAGAATACCCTGATGAGAACTCGAGTTCTCATCAGGGTATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-2470s1c1
Sequence:CCGGCCCTGTGATGGAGAAATGATTCTCGAGAATCATTTCTCCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007192.x-1855s1c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-1705s1c1
Sequence:CCGGCGGGCAGCATTACTTACAGAACTCGAGTTCTGTAAGTAATGCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-640s1c1
Sequence:CCGGCCTGCCATCACACTGCTAATACTCGAGTATTAGCAGTGTGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007192
VALIDATED
SUPT16H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1855s21c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2634s21c1
Sequence:CCGGTGAGCAGATGGAACGAGAAATCTCGAGATTTCTCGTTCCATCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-3952s21c1
Sequence:CCGGACTCAAGGTTCTCGGAAATTTCTCGAGAAATTTCCGAGAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-1407s21c1
Sequence:CCGGCCGTGAAGGCTCCCTAGTAATCTCGAGATTACTAGGGAGCCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007192.3-2193s21c1
Sequence:CCGGTCAGAATGCTTTCCGAATTATCTCGAGATAATTCGGAAAGCATTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-4315s1c1
Sequence:CCGGCCTAGAATACCCTGATGAGAACTCGAGTTCTCATCAGGGTATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-2470s1c1
Sequence:CCGGCCCTGTGATGGAGAAATGATTCTCGAGAATCATTTCTCCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007192.x-1855s1c1
Sequence:CCGGCGCAAGTCTAATGTGTCCTATCTCGAGATAGGACACATTAGACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-1705s1c1
Sequence:CCGGCGGGCAGCATTACTTACAGAACTCGAGTTCTGTAAGTAATGCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007192.x-640s1c1
Sequence:CCGGCCTGCCATCACACTGCTAATACTCGAGTATTAGCAGTGTGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks