EMAIL THIS PAGE TO A FRIEND

SUPT20H

suppressor of Ty 20 homolog (S. cerevisiae)

Synonyms: C13 C13orf19 FAM48A P38IP SPT20 bA421P11.4
UniProtKB ID: Q8NEM7, Q71RF3, Q9Y6A6
Gene ID:
cow(784572) suppressor of Ty 20 homolog (S. cerevisiae)
domestic guinea pig(100717868) suppressor of Ty 20 homolog (S. cerevisiae)
naked mole-rat(101715736) suppressor of Ty 20 homolog (S. cerevisiae)
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017569 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124331 MISSION® esiRNA esiRNA human FAM48A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014286 Rosetta Predictions human pricing
NM_017569 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111834 predicted 1095
2 SASI_Hs01_00111835 predicted 1855
3 SASI_Hs01_00111836 predicted 773
4 SASI_Hs02_00306527 predicted 1489
5 SASI_Hs02_00306528 predicted 974
6 SASI_Hs01_00111838 predicted 1418
7 SASI_Hs01_00111839 predicted 775
8 SASI_Hs01_00111840 predicted 1578
9 SASI_Hs01_00111841 predicted 1959
10 SASI_Hs01_00111842 predicted 1808
11 SASI_Hs01_00111837 predicted 1918
12 SASI_Hs01_00111843 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196230 predicted 1186
2 SASI_Hs01_00196231 predicted 1937
3 SASI_Hs01_00196232 predicted 854
4 SASI_Hs02_00350225 predicted 1579
5 SASI_Hs02_00350226 predicted 1060
6 SASI_Hs01_00196234 predicted 1498
7 SASI_Hs01_00196235 predicted 860
8 SASI_Hs01_00196236 predicted 1657
9 SASI_Hs01_00196237 predicted 2039
10 SASI_Hs01_00196238 predicted 1888
11 SASI_Hs01_00196233 predicted 1997
12 SASI_Hs01_00196239 predicted 1646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017569
VALIDATED
SUPT20H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 20 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-528s21c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-2287s21c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-743s21c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-1831s21c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-1787s1c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-1443s1c1
Sequence:CCGGCCACAGATGATCATTCAAATTCTCGAGAATTTGAATGATCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-484s1c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-2243s1c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-699s1c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017569
VALIDATED
SUPT20H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 20 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-528s21c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-2287s21c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-743s21c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-1831s21c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-1787s1c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-1443s1c1
Sequence:CCGGCCACAGATGATCATTCAAATTCTCGAGAATTTGAATGATCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-484s1c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-2243s1c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-699s1c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017569
VALIDATED
SUPT20H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 20 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-528s21c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-2287s21c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-743s21c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017569.3-1831s21c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-1787s1c1
Sequence:CCGGCCATCAAGTATTCCTCGGAAACTCGAGTTTCCGAGGAATACTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-1443s1c1
Sequence:CCGGCCACAGATGATCATTCAAATTCTCGAGAATTTGAATGATCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017569.2-484s1c1
Sequence:CCGGGCTTGTTATGCAAGAGACTTTCTCGAGAAAGTCTCTTGCATAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-2243s1c1
Sequence:CCGGCCCACAACTTGTAGTCCTCAACTCGAGTTGAGGACTACAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017569.2-699s1c1
Sequence:CCGGGCGGATGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks